CRISPRdirect — Rational design of CRISPR/Cas target.  Help

or Paste a nucleotide sequence: ?

or upload sequence file: ?

PAM sequence requirement: (e.g. NGG, NRG, NNGRRT, NG) ?

Specificity check: ?

Results: ?

Sequence name:
PAM sequence: NGG
Specificity check: Mouse (Mus musculus) genome, GRCm39/mm39 (Jun, 2020)
Time: 2025-05-02 11:10:39

position target sequence sequence information number of target sites ?
start
- end 		+
− 		20mer+PAM (total 23mer) GC% of
20mer 		Tm of
20mer 		TTTT in
20mer 		restriction
sites 		20mer
+PAM 		12mer
+PAM 		8mer
+PAM
1 - 23 + CTCAGGCCAATGTCACATTGTGG [gRNA] 50.00 % 70.79 °C - [detail] [detail] [detail]

Graphical View:

1020 
CTCAGGCCAATGTCACATTGTGG
>                      
                       

Data Export:

Tab-delimited text can be copy-pasted into spreadsheet softwares (e.g. Excel) or text editors.

CRISPRdirect | DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use CRISPRdirect in your work, please cite:
Naito Y, Hino K, Bono H, Ui-Tei K. (2015)
CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites.
Bioinformatics, 31, 1120-1123. [Full Text]