— Rational design of CRISPR/Cas target.

About CRISPRdirect

CRISPRdirect is a web server for selecting rational CRISPR/Cas targets from an input sequence.
All services of the CRISPRdirect web server are provided free of charge to all users.

Tutorial video

Acknowledgement: We thank Ms. Junko Morita for making the tutorial video on TogoTV.

Example

Example 1 | Selecting target sites for human B melanoma antigen (BAGE) gene

1. Enter the accession number for human BAGE gene (NM_001187).
2. Click 'retrieve sequence' to get nucleotide sequence from GenBank.
   Show example:
3. Or you can directly paste a nucleotide sequence.
   FASTA format or a plain nucleotide sequence up to 10 kbp is accepted.
4. Or you can upload a sequence file, in plain text format. (not MS Word .doc file!)
   FASTA format or a plain nucleotide sequence up to 10 kbp is accepted.
5. PAM sequence requirement (default: NGG).
   An arbitrary sequence using IUB codes (N, R, Y, ...) can be specified.
6. Select 'Human genome, GRCh37/hg19 (Feb, 2009)' to check for off-targets.
7. Click 'design'.
   Show example:

Results

1. Target positions.
2. Target sequences, 20mer + 3mer PAM (total 23mer).
3. GC content of the target 20mer.
4. Calculated Tm of the target 20mer.
5. Presence or absence of TTTT (four consecutive T’s that cause pol III termination) in the target 20mer. Avoid TTTT in gRNA vectors with pol III promoter.
6. Off-target search results against human genome. The number of target sites with perfect match is shown. Note that the number displayed here includes both on-target and off-target sites. Smaller number (but not zero) is better for these columns to avoid off-target editing.
   • 20mer+PAM: The target sequence (20mer) adjacent to the PAM is searched against the genome. One ('1') in this column usually indicates that the sequence has only one perfect match with the intended target (e.g., BAGE locus in the genome). Zero ('0') in this column means that the sequence has no match in the genomic sequence; such sequences may possibly span over exon-exon junctions, so their use should be avoided.
   • 12mer+PAM: The 12mer of 3′ region of the target sequence adjacent to the PAM is searched against the genome. The region contains critical residues determining target specificity.
   • 8mer+PAM: The 8mer of 3′ region of the target sequence adjacent to the PAM is searched against the genome. The region contains the most critical residues determining target specificity.

7. Only one match in 20mer+PAM and 12mer+PAM search. These targets are highly specific.
   → Recommended for CRISPR/Cas target. Target positions are highlighted with green (e.g., 163 - 185).
8. No match in 20mer+PAM search. Possibly the sequence spans over exon-exon junction, so avoid using these.
   → Not recommended for CRISPR/Cas target.
9. Very high number of off-target hits. Avoid using these sequences.
   → Not recommended for CRISPR/Cas target.

Graphical view

A graphical view of target sites demonstrates the position and orientation of each site.

Saving and exporting the results

10. Tab-delimited text can be displayed or downloaded as a file.
11. JSON format output is also available.
12. Tab-delimited text, ready-to-use for copy-pasting into Excel or text editors, etc.

The result page can also be saved as HTML file and opened by a web browser again.

Example 2 | Analyzing an existing gRNA target sequence

1. Any 20 nt sequence followed by PAM (i.e. NGG) can be simply submitted as an input.
   An example for verifying the target sequence 'ACCTCTCTGAGGCTGCCAACCGG':

Methods

Specificity check

The number of target sites in the genome (including both on-target and off-target sites) is displayed using Jellyfish k-mer counting software. A detailed list of off-target candidates are displayed using GGGenome REST API. GGGenome quickly searches short nucleotide sequences allowing mismatches and gaps utilizing suffix arrays and inverse suffix links indexed on solid state drive (SSD).

Specificity check can be performed for following species:

Illustrated overview of specificity check

API

CRISPRdirect results can be directly retrieved in HTML, tab-delimited text or JSON format by simply POSTing these values to https://crispr.dbcls.jp/ using any kind of language or script. A sample Perl code is available from GitHub.

Useful tools

• GGGenome: ultrafast genome sequence search engine maintained by our group.
  https://GGGenome.dbcls.jp/
• siDirect: highly effective, target-specific siRNA design software maintained by our group.
  http://siDirect2.RNAi.jp/
• CRISPRdirect_crawl.pl: s short perl script to retrieve CRISPRdirect results.
  https://github.com/meso-cacase/CRISPRdirect_crawl

Reference

If you use CRISPRdirect in your work, please cite:

• Naito Y, Hino K, Bono H, Ui-Tei K. (2015)
  CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites.
  Bioinformatics, 31, 1120-1123.

What's new

• 2020-11-07 Added mouse genome GRCm39/mm39.
• 2020-09-11 Longer/shorter PAM supported. (e.g. NNGRRT, NG)
• 2018-05-07 Added 12 genomes - List
• 2017-12-11 Added carrot genome v2.0 from Phytozome.
• 2017-11-30 Added 376 genomes from CyanoBase - List
• 2017-11-08 Added 5 species - List
• 2017-06-19 Added 8 species - List
• 2017-06-09 Added Human Japanese Reference Genome JRGv2.
• 2017-02-17 Brassica rapa genome v1.5 is available.
• 2017-01-23 Added 8 species - List
• 2016-12-14 CRISPRdirect shows restriction enzyme cutting sites - Sample
• 2016-09-09 Added 10 species - List
• 2016-08-30 Added Human Japanese Reference Genome JRGv1.
• 2016-06-14 Added 10 species - List
• 2015-10-05 CRISPRdirect supports 200+ species - List of species
• 2015-01-13 HTTPS encrypted connections supported - https://crispr.dbcls.jp/
• 2014-11-21 CRISPRdirect paper has been published in Bioinformatics - Full text

CRISPRdirect team

Yuki Naito¹, Kimihiro Hino², Hidemasa Bono¹, Kumiko Ui-Tei^2
1Database Center for Life Science (DBCLS) and ²University of Tokyo

CRISPRdirect | DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use CRISPRdirect in your work, please cite:
Naito Y, Hino K, Bono H, Ui-Tei K. (2015)
CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites.
Bioinformatics, 31, 1120-1123. [Full Text]