CRISPRdirect — Rational design of CRISPR/Cas target.

About CRISPRdirect

CRISPRdirect is a web server for selecting rational CRISPR/Cas targets from an input sequence.
All services of the CRISPRdirect web server are provided free of charge to all users.

Tutorial video

CRISPRdirect: designing CRISPR/Cas guide RNA sequence

Acknowledgement: We thank Ms. Junko Morita for making the tutorial video on TogoTV.

Example

Example 1 | Selecting target sites for human B melanoma antigen (BAGE) gene
  1. Enter the accession number for human BAGE gene (NM_001187).
  2. Click 'retrieve sequence' to get nucleotide sequence from GenBank.
    Show example:
  3. Or you can directly paste a nucleotide sequence.
    FASTA format or a plain nucleotide sequence up to 10 kbp is accepted.
  4. Or you can upload a sequence file, in plain text format. (not MS Word .doc file!)
    FASTA format or a plain nucleotide sequence up to 10 kbp is accepted.
  5. PAM sequence requirement (default: NGG).
    An arbitrary 3 nt sequence using IUB codes (N, R, Y, ...) can be specified.
  6. Select 'Human genome, GRCh37/hg19 (Feb, 2009)' to check for off-targets.
  7. Click 'design'.
    Show example:
Results
  1. Target positions.
  2. Target sequences, 20mer + 3mer PAM (total 23mer).
  3. GC content of the target 20mer.
  4. Calculated Tm of the target 20mer.
  5. Presence or absence of TTTT (four consecutive T’s that cause pol III termination) in the target 20mer. Avoid TTTT in gRNA vectors with pol III promoter.
  6. Off-target search results against human genome. The number of target sites with perfect match is shown. Note that the number displayed here includes both on-target and off-target sites. Smaller number (but not zero) is better for these columns to avoid off-target editing.
  1. Only one match in 20mer+PAM and 12mer+PAM search. These targets are highly specific.
    → Recommended for CRISPR/Cas target. Target positions are highlighted with green (e.g., 163 - 185).
  2. No match in 20mer+PAM search. Possibly the sequence spans over exon-exon junction, so avoid using these.
    → Not recommended for CRISPR/Cas target.
  3. Very high number of off-target hits. Avoid using these sequences.
    → Not recommended for CRISPR/Cas target.
Graphical view

A graphical view of target sites demonstrates the position and orientation of each site.

Saving and exporting the results
  1. Tab-delimited text can be displayed or downloaded as a file.
  2. JSON format output is also available.
  3. Tab-delimited text, ready-to-use for copy-pasting into Excel or text editors, etc.

The result page can also be saved as HTML file and opened by a web browser again.

Example 2 | Analyzing an existing gRNA target sequence
  1. Any 20 nt sequence followed by PAM (i.e. NGG) can be simply submitted as an input.
    An example for verifying the target sequence 'ACCTCTCTGAGGCTGCCAACCGG':

Methods

Specificity check

The number of target sites in the genome (including both on-target and off-target sites) is displayed using Jellyfish k-mer counting software. A detailed list of off-target candidates are displayed using GGGenome REST API. GGGenome quickly searches short nucleotide sequences allowing mismatches and gaps utilizing suffix arrays and inverse suffix links indexed on solid state drive (SSD).

Specificity check can be performed for following species:

Database Source Group Species Latin name Assembly information
hg38 UCSC Mammal Human Homo sapiens GRCh38/hg38 (Dec, 2013)
hg19 UCSC Mammal Human Homo sapiens GRCh37/hg19 (Feb, 2009)
hg18 UCSC Mammal Human Homo sapiens NCBI36/hg18 (Mar, 2006)
mm10 UCSC Mammal Mouse Mus musculus GRCm38/mm10 (Dec, 2011)
mm9 UCSC Mammal Mouse Mus musculus NCBI37/mm9 (Jul, 2007)
MSMv3 Mammal Mouse Mus musculus MSMv3
JF1v2 Mammal Mouse Mus musculus JF1v2
rn6 UCSC Mammal Rat Rattus norvegicus RGSC 6.0/rn6 (Jul, 2014)
rn5 UCSC Mammal Rat Rattus norvegicus RGSC 5.0/rn5 (Mar, 2012)
vicPac2 UCSC Mammal Alpaca Vicugna pacos Vicugna_pacos-2.0.1/vicPac2 (Mar, 2013)
dasNov3 UCSC Mammal Armadillo Dasypus novemcinctus Baylor/dasNov3 (Dec, 2011)
papAnu2 UCSC Mammal Baboon Papio anubis Baylor Panu_2.0/papAnu2 (Mar, 2012)
otoGar3 UCSC Mammal Bushbaby Otolemur garnettii Broad/otoGar3 (Mar, 2011)
felCat5 UCSC Mammal Cat Felis catus ICGSC Felis_catus 6.2/felCat5 (Sep, 2011)
panTro4 UCSC Mammal Chimpanzee Pan troglodytes CSAC 2.1.4/panTro4 (Feb, 2011)
criGri1 UCSC Mammal Chinese hamster Cricetulus griseus C_griseus_v1.0/criGri1 (Jul, 2013)
bosTau8 UCSC Mammal Cow Bos taurus Bos_taurus_UMD_3.1.1/bosTau8 (Jun, 2014)
canFam3 UCSC Mammal Dog Canis familiaris Broad CanFam3.1/canFam3 (Sep, 2011)
turTru2 UCSC Mammal Dolphin Tursiops truncatus Baylor Ttru_1.4/turTru2 (Oct, 2011)
loxAfr3 UCSC Mammal Elephant Loxodonta africana Broad/loxAfr3 (Jul, 2009)
musFur1 UCSC Mammal Ferret Mustela putorius furo MusPutFur1.0/musFur1 (Apr, 2011)
nomLeu3 UCSC Mammal Gibbon Nomascus leucogenys GGSC Nleu3.0/nomLeu3 (Oct, 2012)
gorGor3 UCSC Mammal Gorilla Gorilla gorilla gorilla gorGor3.1/gorGor3 (May, 2011)
cavPor3 UCSC Mammal Guinea pig Cavia porcellus Broad/cavPor3 (Feb, 2008)
eriEur2 UCSC Mammal Hedgehog Erinaceus europaeus EriEur2.0/eriEur2 (May, 2012)
equCab2 UCSC Mammal Horse Equus caballus Broad/equCab2 (Sep, 2007)
dipOrd1 UCSC Mammal Kangaroo rat Dipodomys ordii Broad/dipOrd1 (Jul, 2008)
triMan1 UCSC Mammal Manatee Trichechus manatus latirostris Broad v1.0/triMan1 (Oct, 2011)
calJac3 UCSC Mammal Marmoset Callithrix jacchus WUGSC 3.2/calJac3 (Mar, 2009)
pteVam1 UCSC Mammal Megabat Pteropus vampyrus Broad/pteVam1 (Jul, 2008)
myoLuc2 UCSC Mammal Microbat Myotis lucifugus Broad Institute Myoluc2.0/myoLuc2 (Jul, 2010)
balAcu1 UCSC Mammal Minke whale Balaenoptera acutorostrata scammoni BalAcu1.0/balAcu1 (Oct, 2013)
micMur1 UCSC Mammal Mouse lemur Microcebus murinus Broad/micMur1 (Jul, 2007)
hetGla2 UCSC Mammal Naked mole rat Heterocephalus glaber Broad HetGla_female_1.0/hetGla2 (Jan, 2012)
monDom5 UCSC Mammal Opossum Monodelphis domestica Broad/monDom5 (Oct, 2006)
ponAbe2 UCSC Mammal Orangutan Pongo abelii WUGSC 2.0.2/ponAbe2 (Jul, 2007)
ailMel1 UCSC Mammal Panda Ailuropoda melanoleuca BGI-Shenzhen 1.0/ailMel1 (Dec, 2009)
susScr3 UCSC Mammal Pig Sus scrofa SGSC Sscrofa10.2/susScr3 (Aug, 2011)
ochPri3 UCSC Mammal Pika Ochotona princeps OchPri3.0/ochPri3 (May, 2012)
ornAna1 UCSC Mammal Platypus Ornithorhynchus anatinus WUGSC 5.0.1/ornAna1 (Mar, 2007)
oryCun2 UCSC Mammal Rabbit Oryctolagus cuniculus Broad/oryCun2 (Apr, 2009)
rheMac3 UCSC Mammal Rhesus macaque Macaca mulatta BGI CR_1.0/rheMac3 (Oct, 2010)
proCap1 UCSC Mammal Rock hyrax, Cape hyrax Procavia capensis Broad/proCap1 (Jul, 2008)
oviAri3 UCSC Mammal Sheep Ovis aries ISGC Oar_v3.1/oviAri3 (Aug, 2012)
sorAra2 UCSC Mammal Shrew Sorex araneus Broad/sorAra2 (Aug, 2008)
choHof1 UCSC Mammal Sloth Choloepus hoffmanni Broad/choHof1 (Jul, 2008)
speTri2 UCSC Mammal Squirrel Spermophilus tridecemlineatus Broad/speTri2 (Nov, 2011)
saiBol1 UCSC Mammal Squirrel monkey Saimiri boliviensis Broad/saiBol1 (Oct, 2011)
tarSyr1 UCSC Mammal Tarsier Tarsius syrichta Broad/tarSyr1 (Aug, 2008)
sarHar1 UCSC Mammal Tasmanian devil Sarcophilus harrisii WTSI Devil_ref v7.0/sarHar1 (Feb, 2011)
echTel2 UCSC Mammal Tenrec Echinops telfairi Broad/echTel2 (Nov, 2012)
tupBel1 UCSC Mammal Tree shrew Tupaia belangeri Broad/tupBel1 (Dec, 2006)
macEug2 UCSC Mammal Wallaby Macropus eugenii TWGS Meug_1.1/macEug2 (Sep, 2009)
cerSim1 UCSC Mammal White rhinoceros Ceratotherium simum CerSimSim1.0/cerSim1 (May, 2012)
allMis1 UCSC Vertebrate American alligator Alligator mississippiensis allMis0.2/allMis1 (Aug, 2012)
gadMor1 UCSC Vertebrate Atlantic cod Gadus morhua Genofisk GadMor_May2010/gadMor1 (May, 2010)
melUnd1 UCSC Vertebrate Budgerigar Melopsittacus undulatus WUSTL v6.3/melUnd1 (Sep, 2011)
galGal4 UCSC Vertebrate Chicken Gallus gallus ICGSC Gallus_gallus-4.0/galGal4 (Nov, 2011)
latCha1 UCSC Vertebrate Coelacanth Latimeria chalumnae Broad/latCha1 (Aug, 2011)
calMil1 UCSC Vertebrate Elephant shark Callorhinchus milii Callorhinchus_milii-6.1.3/calMil1 (Dec, 2013)
fr3 UCSC Vertebrate Fugu Takifugu rubripes FUGU5/fr3 (Oct, 2011)
petMar2 UCSC Vertebrate Lamprey Petromyzon marinus WUGSC 7.0/petMar2 (Sep, 2010)
anoCar2 UCSC Vertebrate Lizard Anolis carolinensis Broad AnoCar2.0/anoCar2 (May, 2010)
oryLat2 UCSC Vertebrate Medaka Oryzias latipes NIG/UT MEDAKA1/oryLat2 (Oct, 2005)
geoFor1 UCSC Vertebrate Medium ground finch Geospiza fortis GeoFor_1.0/geoFor1 (Apr, 2012)
oreNil2 UCSC Vertebrate Nile tilapia Oreochromis niloticus Broad oreNil1.1/oreNil2 (Jan, 2011)
chrPic1 UCSC Vertebrate Painted turtle Chrysemys picta bellii v3.0.1/chrPic1 (Dec, 2011)
gasAcu1 UCSC Vertebrate Stickleback Gasterosteus aculeatus Broad/gasAcu1 (Feb, 2006)
tetNig2 UCSC Vertebrate Tetraodon Tetraodon nigroviridis Genoscope 8.0/tetNig2 (Mar, 2007)
melGal1 UCSC Vertebrate Turkey Meleagris gallopavo TGC Turkey_2.01/melGal1 (Dec, 2009)
xenTro3 UCSC Vertebrate Western clawed frog Xenopus tropicalis JGI 4.2/xenTro3 (Nov, 2009)
taeGut2 UCSC Vertebrate Zebra finch Taeniopygia guttata WashU taeGut324/taeGut2 (Feb, 2013)
danRer7 UCSC Vertebrate Zebrafish Danio rerio Zv9/danRer7 (Jul, 2010)
ci2 UCSC Deuterostome Transparent sea squirt Ciona intestinalis JGI 2.1/ci2 (Mar, 2005)
braFlo1 UCSC Deuterostome Lancelet Branchiostoma floridae JGI 1.0/braFlo1 (Mar, 2006)
strPur2 UCSC Deuterostome Purple sea urchin Strongylocentrotus purpuratus Baylor 2.1/strPur2 (Sep, 2006)
anoGam1 UCSC Insect African malaria mosquito Anopheles gambiae IAGEC MOZ2/anoGam1 (Feb, 2003)
apiMel2 UCSC Insect Honeybee Apis mellifera Baylor 2.0/apiMel2 (Jan, 2005)
droAna2 UCSC Insect D. ananassae (Fruit fly) Drosophila ananassae Agencourt prelim/droAna2 (Aug, 2005)
droEre1 UCSC Insect D. erecta (Fruit fly) Drosophila erecta Agencourt prelim/droEre1 (Aug, 2005)
droGri1 UCSC Insect D. grimshawi (Fruit fly) Drosophila grimshawi Agencourt prelim/droGri1 (Aug, 2005)
dm6 UCSC Insect D. melanogaster (Fruit fly) Drosophila melanogaster BDGP Release 6 + ISO1 MT/dm6 (Aug, 2014)
dm3 UCSC Insect D. melanogaster (Fruit fly) Drosophila melanogaster BDGP R5/dm3 (Apr, 2006)
droMoj2 UCSC Insect D. mojavensis (Fruit fly) Drosophila mojavensis Agencourt prelim/droMoj2 (Aug, 2005)
droPer1 UCSC Insect D. persimilis (Fruit fly) Drosophila persimilis Broad/droPer1 (Oct, 2005)
dp3 UCSC Insect D. pseudoobscura (Fruit fly) Drosophila pseudoobscura FlyBase 1.03/dp3 (Nov, 2004)
droSec1 UCSC Insect D. sechellia (Fruit fly) Drosophila sechellia Broad/droSec1 (Oct, 2005)
droSim1 UCSC Insect D. simulans (Fruit fly) Drosophila simulans WUGSC mosaic 1.0/droSim1 (Apr, 2005)
droVir2 UCSC Insect D. virilis (Fruit fly) Drosophila virilis Agencourt prelim/droVir2 (Aug, 2005)
droYak2 UCSC Insect D. yakuba (Fruit fly) Drosophila yakuba WUGSC 7.1/droYak2 (Nov, 2005)
caePb2 UCSC Nematode C. brenneri (Nematode worm) Caenorhabditis brenneri WUGSC 6.0.1/caePb2 (Feb, 2008)
cb3 UCSC Nematode C. briggsae (Nematode worm) Caenorhabditis briggsae WUGSC 1.0/cb3 (Jan, 2007)
ce10 UCSC Nematode C. elegans (Nematode worm) Caenorhabditis elegans WS220/ce10 (Oct, 2010)
caeJap1 UCSC Nematode C. japonica (Nematode worm) Caenorhabditis japonica WUGSC 3.0.2/caeJap1 (Mar, 2008)
caeRem3 UCSC Nematode C. remanei (Nematode worm) Caenorhabditis remanei WUGSC 15.0.1/caeRem3 (May, 2007)
priPac1 UCSC Nematode P. pacificus (Parasitic nematode) Pristionchus pacificus WUGSC 5.0/priPac1 (Feb, 2007)
sacCer3 UCSC Other Budding yeast Saccharomyces cerevisiae SacCer_Apr2011/sacCer3 (Apr, 2011)
aplCal1 UCSC Other Sea hare Aplysia californica Broad 2.0/aplCal1 (Sep, 2008)
eboVir3 UCSC Viruses Ebola virus Filoviridae ebolavirus Sierra Leone G3683/KM034562.1/eboVir3 (Jun, 2014)
OryAfe1.0 Ensembl Mammal Aardvark Orycteropus afer OryAfe1.0 (May, 2012)
PoeFor_5.1.2 Ensembl Vertebrate Amazon molly Poecilia formosa Poecilia_formosa-5.1.2 (Oct, 2013)
CSAV2.0 Ensembl Deuterostome Pacific transparent sea squirt Ciona savignyi CSAV 2.0 (Oct, 2005)
AstMex102 Ensembl Vertebrate Blind cave fish Astyanax mexicanus AstMex102 (Apr, 2013)
PelSin_1.0 Ensembl Vertebrate Chinese softshell turtle Pelodiscus sinensis PelSin_1.0 (Oct, 2011)
MacFas5.0 Ensembl Mammal Crab-eating macaque Macaca fascicularis MacFas5.0 (Jun, 2013)
BGI_duck_1.0 Ensembl Vertebrate Duck Anas platyrhynchos BGI_duck_1.0 (Apr, 2013)
FicAlb_1.4 Ensembl Vertebrate Flycatcher Ficedula albicollis FicAlb_1.4 (Jan, 2012)
Pham Ensembl Mammal Hamadryas baboon Papio hamadryas Pham (Nov, 2008)
Xipmac4.4.2 Ensembl Vertebrate Platyfish Xiphophorus maculatus Xipmac4.4.2 (Jan, 2012)
MicOch1.0 Ensembl Mammal Prairie vole Microtus ochrogaster MicOch1.0 (Nov, 2012)
PhyMac_2.0.2 Ensembl Mammal Sperm whale Physeter macrocephalus PhyMac_2.0.2 (Sep, 2013)
LepOcu1 Ensembl Vertebrate Spotted gar Lepisosteus oculatus LepOcu1 (Dec, 2011)
ChlSab1.1 Ensembl Mammal Green monkey Chlorocebus sabaeus ChlSab1.1 (Mar, 2014)
Acyr_2.0 EnsemblMetazoa Insect Pea aphid Acyrthosiphon pisum Acyr_2.0 (Jun, 2010)
AaegL3 EnsemblMetazoa Insect Yellowfever mosquito Aedes aegypti AaegL3 (Dec, 2013)
Aqu1 EnsemblMetazoa Metazoa Sponge Amphimedon queenslandica Aqu1 (Oct, 2010)
AdarC3 EnsemblMetazoa Insect Mosquito Anopheles darlingi AdarC3 (Jan, 2014)
Attacep1.0 EnsemblMetazoa Insect Leafcutter ant Atta cephalotes Attacep1.0 (Jul, 2012)
ASM15162v1 EnsemblMetazoa Insect Silkworm Bombyx mori ASM15162v1 (Feb, 2013)
B_malayi_3.0 EnsemblMetazoa Nematode Filarial nematode worm Brugia malayi B_malayi-3.0 (Dec, 2012)
Capte_v1.0 EnsemblMetazoa Metazoa Polychaete worm Capitella teleta Capitella teleta v1.0 (Dec, 2012)
oyster_v9 EnsemblMetazoa Metazoa Pacific oyster Crassostrea gigas oyster_v9 (Sep, 2012)
CpipJ2 EnsemblMetazoa Insect Southern house mosquito Culex quinquefasciatus CpipJ2 (Jan, 2007)
DanPle_1.0 EnsemblMetazoa Insect Monarch butterfly Danaus plexippus DanPle_1.0 (Nov, 2011)
Dappu_V1.0 EnsemblMetazoa Metazoa Water flea Daphnia pulex V1.0 (Feb, 2011)
DendPond_1.0 EnsemblMetazoa Insect Mountain pine beetle Dendroctonus ponderosae DendPond_male_1.0 (Apr, 2013)
dwil_caf1 EnsemblMetazoa Insect D. willistoni (Fruit fly) Drosophila willistoni dwil_caf1 (Jul, 2008)
Hmel1 EnsemblMetazoa Insect Postman butterfly Heliconius melpomene Hmel1 (Feb, 2012)
Helro1 EnsemblMetazoa Metazoa Californian leech Helobdella robusta Helro1 (Dec, 2012)
IscaW1 EnsemblMetazoa Metazoa Black-legged tick Ixodes scapularis IscaW1 (Aug, 2007)
Loa_loa_V3 EnsemblMetazoa Nematode Eye worm Loa loa Loa_loa_V3 (Jan, 2010)
Lotgi1 EnsemblMetazoa Metazoa Giant owl limpet Lottia gigantea Lotgi1 (Jan, 2013)
Msca1 EnsemblMetazoa Insect Humpbacked fly Megaselia scalaris Msca1 (Feb, 2013)
MelCinx1.0 EnsemblMetazoa Insect Glanville fritillary Melitaea cinxia MelCinx1.0 (Jul, 2014)
MneLei EnsemblMetazoa Metazoa Sea walnut Mnemiopsis leidyi MneLei_Aug2011 (Sep, 2011)
Nvit_2.1 EnsemblMetazoa Insect Parasitic wasp Nasonia vitripennis Nvit_2.1 (Nov, 2012)
ASM20922v1 EnsemblMetazoa Metazoa Starlet sea anemone Nematostella vectensis ASM20922v1 (Sep, 2007)
Cameroon_v3 EnsemblMetazoa Nematode O. volvulus (Parasitic nematode) Onchocerca volvulus Cameroon_v3 (Nov, 2013)
PhumU2 EnsemblMetazoa Insect Body louse Pediculus humanus PhumU2 (Nov, 2008)
RproC1 EnsemblMetazoa Insect Triatomid bug Rhodnius prolixus RproC1 (Dec, 2010)
ASM23792v2 EnsemblMetazoa Metazoa Blood fluke Schistosoma mansoni ASM23792v2 (Apr, 2012)
Si_gnG EnsemblMetazoa Insect Red imported fire ant Solenopsis invicta Si_gnG (Feb, 2011)
Smar1 EnsemblMetazoa Metazoa European centipede Strigamia maritima Smar1 (Feb, 2013)
ASM23943v1 EnsemblMetazoa Metazoa Two-spotted spider mite Tetranychus urticae ASM23943v1 (Nov, 2011)
Tcas3 EnsemblMetazoa Insect Red flour beetle Tribolium castaneum Tcas3 (Feb, 2010)
Tspiralis1 EnsemblMetazoa Nematode Trichina worm Trichinella spiralis Tspiralis1 (Mar, 2011)
ASM15027v1 EnsemblMetazoa Metazoa T. adhaerens Trichoplax adhaerens ASM15027v1 (Aug, 2006)
ZooNev1.0 EnsemblMetazoa Insect Dampwood termite Zootermopsis nevadensis ZooNev1.0 (Jun, 2014)
ASM34733v1 EnsemblPlants Plant Tausch's goatgrass Aegilops tauschii ASM34733v1 (Dec, 2013)
AMTR1.0 EnsemblPlants Plant A. trichopoda Amborella trichopoda AMTR1.0 (Jan, 2014)
Araly_v.1.0 EnsemblPlants Plant Lyre-leaved rock-cress Arabidopsis lyrata v.1.0 (Dec, 2008)
TAIR10_en EnsemblPlants Plant Thale cress Arabidopsis thaliana TAIR10 (Sep, 2010)
Bradi_v1.0 EnsemblPlants Plant Purple false brome Brachypodium distachyon v1.0 (Jan, 2009)
Braol_v2.1 EnsemblPlants Plant Wild cabbage Brassica oleracea v2.1
Brapa_v1.5 Plant Chinese cabbage Brassica rapa ssp. pekinensis v1.5 (May, 2013)
IVFCAASv1 EnsemblPlants Plant Chinese cabbage Brassica rapa ssp. pekinensis IVFCAASv1 (Aug, 2009)
Chlre_v3.1 EnsemblPlants Plant Green algae Chlamydomonas reinhardtii v3.1 (Nov, 2007)
ASM9120v1 EnsemblPlants Plant Red alga Cyanidioschyzon merolae ASM9120v1 (Nov, 2008)
Soybn_V1.0 EnsemblPlants Plant Soybean Glycine max V1.0 (Jan, 2010)
Horvu_v1 EnsemblPlants Plant Barley Hordeum vulgare 082214v1 (Mar, 2012)
Lperr_V1.4 EnsemblPlants Plant L. perrieri Leersia perrieri Lperr_V1.4 (Mar, 2014)
MedtrA17_4.0 EnsemblPlants Plant Barrel medic Medicago truncatula str. A17 MedtrA17_4.0 (Jun, 2014)
MA1 EnsemblPlants Plant Banana Musa acuminata MA1 (Aug, 2012)
Obart_v1.0 EnsemblPlants Plant African wild rice Oryza barthii Obart_v1.0 (Apr, 2014)
Orybr_v1.4b EnsemblPlants Plant African wild rice Oryza brachyantha Oryza_brachyantha.v1.4b (May, 2011)
AGI1.1 EnsemblPlants Plant African wild rice Oryza glaberrima AGI1.1 (May, 2011)
Orygl EnsemblPlants Plant Brazilian wild rice Oryza glumaepatula ALNU02000000 (Aug, 2013)
Orylo_v0117 EnsemblPlants Plant Longstamen rice Oryza longistaminata v0117-2013Aug (Aug, 2013)
Oryme_v1.3 EnsemblPlants Plant Australian wild rice Oryza meridionalis Oryza_meridionalis_v1.3 (Oct, 2014)
Oryni EnsemblPlants Plant Indian wild rice Oryza nivara AWHD00000000 (Aug, 2013)
Orypu EnsemblPlants Plant Red rice Oryza punctata AVCL00000000 (Aug, 2013)
PRJEB4137 EnsemblPlants Plant Brownbeard rice Oryza rufipogon PRJEB4137 (Aug, 2013)
ASM465v1 EnsemblPlants Plant Rice (Indica) Oryza sativa ssp. indica ASM465v1 (Jan, 2005)
ASM9206v1 EnsemblPlants Plant O. lucimarinus Ostreococcus lucimarinus ASM9206v1 (Jan, 2011)
ASM242v1 EnsemblPlants Plant Moss Physcomitrella patens ASM242v1 (Jul, 2006)
Poptr_JGI2.0 EnsemblPlants Plant Western balsam poplar Populus trichocarpa JGI2.0 (Jan, 2010)
Prupe1_0 EnsemblPlants Plant Peach Prunus persica Prupe1_0 (Mar, 2013)
Selml_v1.0 EnsemblPlants Plant Spikemoss Selaginella moellendorffii v1.0 (May, 2011)
Setit_JGIv2.0 EnsemblPlants Plant Foxtail millet Setaria italica JGIv2.0 (Jan, 2012)
SL2.50 EnsemblPlants Plant Tomato Solanum lycopersicum str. Heinz 1706 SL2.50 (Oct, 2014)
SolTub_3.0 EnsemblPlants Plant Potato Solanum tuberosum SolTub_3.0 (May, 2011)
Sorbi1 EnsemblPlants Plant Sorghum Sorghum bicolor Sorbi1 (Dec, 2007)
Thecc_20110822 EnsemblPlants Plant Cacao Theobroma cacao Theobroma_cacao_20110822 (May, 2014)
IWGSC1.0 EnsemblPlants Plant Wheat Triticum aestivum IWGSC1.0+popseq (Nov, 2014)
ASM34745v1 EnsemblPlants Plant Red wild einkorn Triticum urartu ASM34745v1 (Apr, 2013)
IGGP_12x EnsemblPlants Plant Grape Vitis vinifera IGGP_12x (Jun, 2011)
AGPv3 EnsemblPlants Plant Maize, Corn Zea mays AGPv3 (Apr, 2013)
Ppatens_251_v3 Phytozome Plant Moss Physcomitrella patens v3.0 (Oct, 2007)
Smoellendorffii_91_v1 Phytozome Plant Spikemoss Selaginella moellendorffii v1.0 (Dec, 2007)
Creinhardtii_281_v5_5 Phytozome Plant Green algae Chlamydomonas reinhardtii v5.5 (May, 2014)
Olucimarinus_231_v2 Phytozome Plant O. lucimarinus Ostreococcus lucimarinus v2.0 (Jan, 2011)
Cgrandiflora_v1 Phytozome Plant C. grandiflora Capsella grandiflora v1.1
Crubella_v1 Phytozome Plant Red shepherd's purse Capsella rubella v1.0
Cpapaya_r.Dec2008 Phytozome Plant Papaya Carica papaya ASGPBv0.4
CsubellipsoideaC169_v2.0 Phytozome Plant C. subellipsoidea Coccomyxa subellipsoidea v2.0
Csativus_v1 Phytozome Plant Cucumber Cucumis sativus v1.0
Egrandis_v2.0 Phytozome Plant Eucalyptus Eucalyptus grandis v2.0
fragaria_vesca_v2.0.a1 Plant Strawberry Fragaria vesca v2.0.a1 (Dec, 2014)
Fvesca_v1.1 Phytozome Plant Strawberry Fragaria vesca v1.1
Graimondii_v2.0 Phytozome Plant Cotton Gossypium raimondii v2.1
Lusitatissimum_BGIv1.0 Phytozome Plant Flax Linum usitatissimum v1.0
malus_x_domestica_v1.0p Plant Apple Malus domestica v1.0p (Aug, 2012)
Mdomestica_v1.0 Phytozome Plant Apple Malus domestica v1.0
Mesculenta_v6 Phytozome Plant Cassava Manihot esculenta v6.1
MpusillaCCMP1545_v3.0 Phytozome Plant Picoplanktonic green alga Micromonas pusilla v3.0
MpusillaRCC299_v3.0 Phytozome Plant Picoplanktonic green alga Micromonas pusilla v3.0
Mguttatus_v2.0 Phytozome Plant Monkey flower Mimulus guttatus v2.0
Ppersica_v2.0 Phytozome Plant Peach Prunus persica v2.1
Rcommunis_TIGR.0.1 Phytozome Plant Castor bean Ricinus communis v0.1
Spolyrhiza_v1 Phytozome Plant Giant duckweed Spirodela polyrhiza v2
Vcarteri_v2 Phytozome Plant Green alga Volvox carteri v2.0
Ptrichocarpa_v3.0 Phytozome Plant Western balsam poplar Populus trichocarpa v3.0
Xenla9 Xenbase Vertebrate African clawed frog Xenopus laevis XenBase/JGI 9.1
Xenla7 Xenbase Vertebrate African clawed frog Xenopus laevis JGI 7.1/Xenla7 (Dec, 2013)
Xentr9 Xenbase Vertebrate Western clawed frog Xenopus tropicalis XenBase/JGI 9.0
Xentr8 Xenbase Vertebrate Western clawed frog Xenopus tropicalis XenBase/JGI 8.0
Xentr7 Xenbase Vertebrate Western clawed frog Xenopus tropicalis XenBase/JGI 7.1
TAIR10 Plant Thale cress Arabidopsis thaliana TAIR10 (Nov, 2010)
rice RAP-DB Plant Rice (Japonica) Oryza sativa ssp. japonica Os-Nipponbare-Reference-IRGSP-1.0 (Oct, 2011)
sorBic Plant Sorghum Sorghum bicolor v2.1 (May, 2013)
Brana_v4.1 Genoscope Plant Rapeseed Brassica napus Genoscope v4.1 (Aug, 2014)
lotus_r3.0 Kazusa Plant Japanese trefoil Lotus japonicus build 3.0 (Aug, 2015)
BX Plant Tobacco (BX) Nicotiana tabacum Ntab-BX (2014)
Niben_v1.0.1 Plant Tobacco Nicotiana benthamiana v1.0.1 (Jul, 2014)
adzuki_ver3 Plant Adzuki bean Vigna angularis ver3 (Nov, 2011)
RSA_r1.0 Kazusa Plant Radish Raphanus sativus RSA_r1.0 (May, 2014)
bmor1 Ensembl Insect Silkworm Bombyx mori Bmor1 (Apr, 2008)
pombe EnsemblFungi Fungi Fission yeast (972h-) Schizosaccharomyces pombe ASM294v2 (Nov, 2007)
MG8 EnsemblFungi Fungi Rice blast fungus (70-15) Magnaporthe oryzae MG8 (Sep, 2011)
ASM644v2 EnsemblFungi Fungi Marine yeast (CBS767) Debaryomyces hansenii ASM644v2 (Feb, 2015)
ASM251v1 EnsemblFungi Fungi Kluyveromyces yeast Kluyveromyces lactis ASM251v1 (Feb, 2015)
ASM252v1 EnsemblFungi Fungi Oleaginous yeast Yarrowia lipolytica ASM252v1 (May, 2012)
RR EnsemblFungi Fungi Wheat head blight fungus Fusarium graminearum
(Gibberella zeae)
RR (Nov, 2014)
RHOziaDV1.0 NCBI Fungi Oleaginous yeast (NP11) Rhodotorula toruloides RHOziaDV1.0 (Apr, 2013)
macaque_CE_1 Mammal Crab-eating macaque Macaca fascicularis CE_1.0 (Jul, 2011)
MesAur1.0 Mammal Golden hamster Mesocricetus auratus MesAur1.0 (Mar, 2013)
KH Deuterostome Transparent sea squirt Ciona intestinalis KH (Jul, 2008)
Spur_v3.1 SpBase Deuterostome Purple sea urchin Strongylocentrotus purpuratus Spur_v3.1 (Jun, 2011)
h7 NCBI Metazoa Hydra Hydra vulgaris h7 (Aug, 2008)
Hydra_RP_1.0 NCBI Metazoa Hydra Hydra vulgaris Hydra_RP_1.0 (Oct, 2009)
Tetth TGD Ciliophora T. thermophila Tetrahymena thermophila Tetrahymena thermophila (Jun, 2014)
Tetbo TGD Ciliophora T. borealis Tetrahymena borealis Tetrahymena borealis (Oct, 2012)
Tetel TGD Ciliophora T. elliotti Tetrahymena elliotti Tetrahymena elliotti (Oct, 2012)
Tetma TGD Ciliophora T. malaccensis Tetrahymena malaccensis Tetrahymena malaccensis (Oct, 2012)
img1 IchDB Ciliophora Ciliate Ichthyophthirius multifiliis Ichthyophthirius multifiliis macronuclear genome
stylo StyloDB Ciliophora Ciliate Stylonychia lemnae Stylonychia lemnae macronuclear genome
oxy OxyDB Ciliophora Ciliate Oxytricha trifallax Oxytricha trifallax macronuclear genome
oxymic OxyDB Ciliophora Ciliate Oxytricha trifallax Oxytricha trifallax micronuclear genome
A_nidulans_FGSC_A4 AspGD Fungi A. nidulans (FGSC A4) Aspergillus nidulans
(Emericella nidulans)
s10-m04-r06 (Apr, 2016)
A_fumigatus_Af293 AspGD Fungi A. fumigatus (Af293) Aspergillus fumigatus
(Neosartorya fumigata)
s03-m05-r06 (Apr, 2016)
C_glabrata_CBS138 CGD Fungi C. glabrata (CBS138) Candida glabrata
(Torulopsis glabrata)
s02-m07-r08 (Jun, 2016)
C_albicans_SC5314 CGD Fungi C. albicans (SC5314) Candida albicans Assembly 21, A21-s02-m09-r10 (Feb, 2016)
JCVI_PMFA1_2.0 NCBI Fungi P. marneffei (ATCC 18224) Penicillium marneffei
(Talaromyces marneffei)
JCVI-PMFA1-2.0 (Oct, 2008)
CC3 EnsemblFungi Fungi Inky cap fungus Coprinopsis cinerea
(Hormographiella aspergillata)
CC3 (Aug, 2014)
JRGv1 ToMMo Mammal Human Homo sapiens Japanese Reference Genome, JRGv1 (Aug, 2016)
YOKOZUNA-1 Tardigrada Tardigrade (Water bear) Ramazzottius variornatus YOKOZUNA-1 (Sep, 2016)
ASM15095v2 EnsemblProtists Bacillariophyta Diatom Phaeodactylum tricornutum ASM15095v2 (Feb, 2010)
ASM14940v2 EnsemblProtists Bacillariophyta Diatom Thalassiosira pseudonana ASM14940v2 (May, 2014)
asagao Plant Japanese morning glory Ipomoea nil
(Pharbitis nil)
Tokyo Kokei Standard; TKS (Sep, 2016)
Illustrated overview of specificity check

API

CRISPRdirect results can be directly retrieved in HTML, tab-delimited text or JSON format by simply POSTing these values to http://crispr.dbcls.jp/ using any kind of language or script. A sample Perl code is available from GitHub.

Name Required
or Optional
Description Sample Value
userseq Required A nucleotide sequence; FASTA format or
a plain nucleotide sequence up to 10 kbp.
atgccgcgcgtcgtgcccgaccagagaagc ...
accession Optional Retrieve sequence mode. Set an accession
number to retrieve sequence from GenBank
instead of designing CRISPR/Cas targets.
Genome location is also accepted for
hg19, mm10, rn5, galGal4, xenTro3,
danRer7, ci2, dm3, ce10 and sacCer3.
The variable userseq should be null.
The variable format should be 'html' or 'txt'.
NM_001187,
hg19:chr7:900000-901000
pam Optional An arbitrary 3 nt sequence using IUB codes
can be specified.
NGG (default), NAG, ...
db Optional Set species for off-target searching. hg19 - Human (Homo sapiens); default,
mm10 - Mouse (Mus musculus),
rn5 - Rat (Rattus norvegicus), etc.
[Full list of species]
format Optional Output format. html (default), txt, json
download Optional Set 'download' to download result as a file. download

Useful tools

Reference

If you use CRISPRdirect in your work, please cite:

What's new

CRISPRdirect team

Yuki Naito1, Kimihiro Hino2, Hidemasa Bono1, Kumiko Ui-Tei2
1Database Center for Life Science (DBCLS) and 2University of Tokyo


CRISPRdirect | DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use CRISPRdirect in your work, please cite:
Naito Y, Hino K, Bono H, Ui-Tei K. (2015)
CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites.
Bioinformatics, 31, 1120-1123. [Full Text]