CRISPRdirect — Rational design of CRISPR/Cas target.

About CRISPRdirect

CRISPRdirect is a web server for selecting rational CRISPR/Cas targets from an input sequence.
All services of the CRISPRdirect web server are provided free of charge to all users.

Tutorial video

CRISPRdirect: designing CRISPR/Cas guide RNA sequence

Acknowledgement: We thank Ms. Junko Morita for making the tutorial video on TogoTV.


Example 1 | Selecting target sites for human B melanoma antigen (BAGE) gene
  1. Enter the accession number for human BAGE gene (NM_001187).
  2. Click 'retrieve sequence' to get nucleotide sequence from GenBank.
    Show example:
  3. Or you can directly paste a nucleotide sequence.
    FASTA format or a plain nucleotide sequence up to 10 kbp is accepted.
  4. Or you can upload a sequence file, in plain text format. (not MS Word .doc file!)
    FASTA format or a plain nucleotide sequence up to 10 kbp is accepted.
  5. PAM sequence requirement (default: NGG).
    An arbitrary sequence using IUB codes (N, R, Y, ...) can be specified.
  6. Select 'Human genome, GRCh37/hg19 (Feb, 2009)' to check for off-targets.
  7. Click 'design'.
    Show example:
  1. Target positions.
  2. Target sequences, 20mer + 3mer PAM (total 23mer).
  3. GC content of the target 20mer.
  4. Calculated Tm of the target 20mer.
  5. Presence or absence of TTTT (four consecutive T’s that cause pol III termination) in the target 20mer. Avoid TTTT in gRNA vectors with pol III promoter.
  6. Off-target search results against human genome. The number of target sites with perfect match is shown. Note that the number displayed here includes both on-target and off-target sites. Smaller number (but not zero) is better for these columns to avoid off-target editing.
  1. Only one match in 20mer+PAM and 12mer+PAM search. These targets are highly specific.
    → Recommended for CRISPR/Cas target. Target positions are highlighted with green (e.g., 163 - 185).
  2. No match in 20mer+PAM search. Possibly the sequence spans over exon-exon junction, so avoid using these.
    → Not recommended for CRISPR/Cas target.
  3. Very high number of off-target hits. Avoid using these sequences.
    → Not recommended for CRISPR/Cas target.
Graphical view

A graphical view of target sites demonstrates the position and orientation of each site.

Saving and exporting the results
  1. Tab-delimited text can be displayed or downloaded as a file.
  2. JSON format output is also available.
  3. Tab-delimited text, ready-to-use for copy-pasting into Excel or text editors, etc.

The result page can also be saved as HTML file and opened by a web browser again.

Example 2 | Analyzing an existing gRNA target sequence
  1. Any 20 nt sequence followed by PAM (i.e. NGG) can be simply submitted as an input.
    An example for verifying the target sequence 'ACCTCTCTGAGGCTGCCAACCGG':


Specificity check

The number of target sites in the genome (including both on-target and off-target sites) is displayed using Jellyfish k-mer counting software. A detailed list of off-target candidates are displayed using GGGenome REST API. GGGenome quickly searches short nucleotide sequences allowing mismatches and gaps utilizing suffix arrays and inverse suffix links indexed on solid state drive (SSD).

Specificity check can be performed for following species:

Database Source Group Species Latin name Assembly information
hg38 UCSC Mammal Human Homo sapiens GRCh38/hg38 (Dec, 2013)
hg19 UCSC Mammal Human Homo sapiens GRCh37/hg19 (Feb, 2009)
hg18 UCSC Mammal Human Homo sapiens NCBI36/hg18 (Mar, 2006)
JRGv2 ToMMo Mammal Human Homo sapiens Japanese Reference Genome, JRGv2 (Jun, 2017)
JRGv1 ToMMo Mammal Human Homo sapiens Japanese Reference Genome, JRGv1 (Aug, 2016)
mm39 UCSC Mammal Mouse Mus musculus GRCm39/mm39 (Jun, 2020)
mm10 UCSC Mammal Mouse Mus musculus GRCm38/mm10 (Dec, 2011)
mm9 UCSC Mammal Mouse Mus musculus NCBI37/mm9 (Jul, 2007)
MSMv3 Mammal Mouse Mus musculus MSMv3
JF1v2 Mammal Mouse Mus musculus JF1v2
rn6 UCSC Mammal Rat Rattus norvegicus RGSC 6.0/rn6 (Jul, 2014)
rn5 UCSC Mammal Rat Rattus norvegicus RGSC 5.0/rn5 (Mar, 2012)
vicPac2 UCSC Mammal Alpaca Vicugna pacos Vicugna_pacos-2.0.1/vicPac2 (Mar, 2013)
dasNov3 UCSC Mammal Armadillo Dasypus novemcinctus Baylor/dasNov3 (Dec, 2011)
papAnu2 UCSC Mammal Baboon Papio anubis Baylor Panu_2.0/papAnu2 (Mar, 2012)
otoGar3 UCSC Mammal Bushbaby Otolemur garnettii Broad/otoGar3 (Mar, 2011)
felCat5 UCSC Mammal Cat Felis catus ICGSC Felis_catus 6.2/felCat5 (Sep, 2011)
panTro4 UCSC Mammal Chimpanzee Pan troglodytes CSAC 2.1.4/panTro4 (Feb, 2011)
criGri1 UCSC Mammal Chinese hamster Cricetulus griseus C_griseus_v1.0/criGri1 (Jul, 2013)
bosTau8 UCSC Mammal Cow Bos taurus Bos_taurus_UMD_3.1.1/bosTau8 (Jun, 2014)
bosTau7 UCSC Mammal Cow Bos taurus Btau_4.6.1/bosTau7 (Oct, 2011)
canFam3 UCSC Mammal Dog Canis familiaris Broad CanFam3.1/canFam3 (Sep, 2011)
turTru2 UCSC Mammal Dolphin Tursiops truncatus Baylor Ttru_1.4/turTru2 (Oct, 2011)
loxAfr3 UCSC Mammal Elephant Loxodonta africana Broad/loxAfr3 (Jul, 2009)
musFur1 UCSC Mammal Ferret Mustela putorius furo MusPutFur1.0/musFur1 (Apr, 2011)
nomLeu3 UCSC Mammal Gibbon Nomascus leucogenys GGSC Nleu3.0/nomLeu3 (Oct, 2012)
gorGor3 UCSC Mammal Gorilla Gorilla gorilla gorilla gorGor3.1/gorGor3 (May, 2011)
cavPor3 UCSC Mammal Guinea pig Cavia porcellus Broad/cavPor3 (Feb, 2008)
eriEur2 UCSC Mammal Hedgehog Erinaceus europaeus EriEur2.0/eriEur2 (May, 2012)
equCab2 UCSC Mammal Horse Equus caballus Broad/equCab2 (Sep, 2007)
dipOrd1 UCSC Mammal Kangaroo rat Dipodomys ordii Broad/dipOrd1 (Jul, 2008)
triMan1 UCSC Mammal Manatee Trichechus manatus latirostris Broad v1.0/triMan1 (Oct, 2011)
calJac3 UCSC Mammal Marmoset Callithrix jacchus WUGSC 3.2/calJac3 (Mar, 2009)
pteVam1 UCSC Mammal Megabat Pteropus vampyrus Broad/pteVam1 (Jul, 2008)
myoLuc2 UCSC Mammal Microbat Myotis lucifugus Broad Institute Myoluc2.0/myoLuc2 (Jul, 2010)
balAcu1 UCSC Mammal Minke whale Balaenoptera acutorostrata scammoni BalAcu1.0/balAcu1 (Oct, 2013)
micMur1 UCSC Mammal Mouse lemur Microcebus murinus Broad/micMur1 (Jul, 2007)
hetGla2 UCSC Mammal Naked mole rat Heterocephalus glaber Broad HetGla_female_1.0/hetGla2 (Jan, 2012)
monDom5 UCSC Mammal Opossum Monodelphis domestica Broad/monDom5 (Oct, 2006)
ponAbe2 UCSC Mammal Orangutan Pongo abelii WUGSC 2.0.2/ponAbe2 (Jul, 2007)
ailMel1 UCSC Mammal Panda Ailuropoda melanoleuca BGI-Shenzhen 1.0/ailMel1 (Dec, 2009)
susScr3 UCSC Mammal Pig Sus scrofa SGSC Sscrofa10.2/susScr3 (Aug, 2011)
ochPri3 UCSC Mammal Pika Ochotona princeps OchPri3.0/ochPri3 (May, 2012)
ornAna1 UCSC Mammal Platypus Ornithorhynchus anatinus WUGSC 5.0.1/ornAna1 (Mar, 2007)
oryCun2 UCSC Mammal Rabbit Oryctolagus cuniculus Broad/oryCun2 (Apr, 2009)
rheMac3 UCSC Mammal Rhesus macaque Macaca mulatta BGI CR_1.0/rheMac3 (Oct, 2010)
proCap1 UCSC Mammal Rock hyrax, Cape hyrax Procavia capensis Broad/proCap1 (Jul, 2008)
oviAri3 UCSC Mammal Sheep Ovis aries ISGC Oar_v3.1/oviAri3 (Aug, 2012)
sorAra2 UCSC Mammal Shrew Sorex araneus Broad/sorAra2 (Aug, 2008)
choHof1 UCSC Mammal Sloth Choloepus hoffmanni Broad/choHof1 (Jul, 2008)
speTri2 UCSC Mammal Squirrel Spermophilus tridecemlineatus Broad/speTri2 (Nov, 2011)
saiBol1 UCSC Mammal Squirrel monkey Saimiri boliviensis Broad/saiBol1 (Oct, 2011)
tarSyr1 UCSC Mammal Tarsier Tarsius syrichta Broad/tarSyr1 (Aug, 2008)
sarHar1 UCSC Mammal Tasmanian devil Sarcophilus harrisii WTSI Devil_ref v7.0/sarHar1 (Feb, 2011)
echTel2 UCSC Mammal Tenrec Echinops telfairi Broad/echTel2 (Nov, 2012)
tupBel1 UCSC Mammal Tree shrew Tupaia belangeri Broad/tupBel1 (Dec, 2006)
macEug2 UCSC Mammal Wallaby Macropus eugenii TWGS Meug_1.1/macEug2 (Sep, 2009)
cerSim1 UCSC Mammal White rhinoceros Ceratotherium simum CerSimSim1.0/cerSim1 (May, 2012)
allMis1 UCSC Vertebrate American alligator Alligator mississippiensis allMis0.2/allMis1 (Aug, 2012)
gadMor1 UCSC Vertebrate Atlantic cod Gadus morhua Genofisk GadMor_May2010/gadMor1 (May, 2010)
melUnd1 UCSC Vertebrate Budgerigar Melopsittacus undulatus WUSTL v6.3/melUnd1 (Sep, 2011)
galGal4 UCSC Vertebrate Chicken Gallus gallus ICGSC Gallus_gallus-4.0/galGal4 (Nov, 2011)
latCha1 UCSC Vertebrate Coelacanth Latimeria chalumnae Broad/latCha1 (Aug, 2011)
calMil1 UCSC Vertebrate Elephant shark Callorhinchus milii Callorhinchus_milii-6.1.3/calMil1 (Dec, 2013)
fr3 UCSC Vertebrate Fugu Takifugu rubripes FUGU5/fr3 (Oct, 2011)
petMar2 UCSC Vertebrate Lamprey Petromyzon marinus WUGSC 7.0/petMar2 (Sep, 2010)
anoCar2 UCSC Vertebrate Lizard Anolis carolinensis Broad AnoCar2.0/anoCar2 (May, 2010)
oryLat2 UCSC Vertebrate Medaka Oryzias latipes NIG/UT MEDAKA1/oryLat2 (Oct, 2005)
geoFor1 UCSC Vertebrate Medium ground finch Geospiza fortis GeoFor_1.0/geoFor1 (Apr, 2012)
oreNil2 UCSC Vertebrate Nile tilapia Oreochromis niloticus Broad oreNil1.1/oreNil2 (Jan, 2011)
chrPic1 UCSC Vertebrate Painted turtle Chrysemys picta bellii v3.0.1/chrPic1 (Dec, 2011)
gasAcu1 UCSC Vertebrate Stickleback Gasterosteus aculeatus Broad/gasAcu1 (Feb, 2006)
tetNig2 UCSC Vertebrate Tetraodon Tetraodon nigroviridis Genoscope 8.0/tetNig2 (Mar, 2007)
melGal1 UCSC Vertebrate Turkey Meleagris gallopavo TGC Turkey_2.01/melGal1 (Dec, 2009)
taeGut2 UCSC Vertebrate Zebra finch Taeniopygia guttata WashU taeGut324/taeGut2 (Feb, 2013)
danRer11 UCSC Vertebrate Zebrafish Danio rerio GRCz11/danRer11 (May, 2017)
danRer10 UCSC Vertebrate Zebrafish Danio rerio GRCz10/danRer10 (Sep, 2014)
danRer7 UCSC Vertebrate Zebrafish Danio rerio Zv9/danRer7 (Jul, 2010)
ci2 UCSC Deuterostome Transparent sea squirt Ciona intestinalis JGI 2.1/ci2 (Mar, 2005)
KH Deuterostome Transparent sea squirt Ciona intestinalis KH (Jul, 2008)
Spur_v3.1 SpBase Deuterostome Purple sea urchin Strongylocentrotus purpuratus Spur_v3.1 (Jun, 2011)
braFlo1 UCSC Deuterostome Lancelet Branchiostoma floridae JGI 1.0/braFlo1 (Mar, 2006)
strPur2 UCSC Deuterostome Purple sea urchin Strongylocentrotus purpuratus Baylor 2.1/strPur2 (Sep, 2006)
anoGam1 UCSC Insect African malaria mosquito Anopheles gambiae IAGEC MOZ2/anoGam1 (Feb, 2003)
apiMel2 UCSC Insect Honeybee Apis mellifera Baylor 2.0/apiMel2 (Jan, 2005)
dm6 UCSC Insect D. melanogaster (Fruit fly) Drosophila melanogaster BDGP Release 6 + ISO1 MT/dm6 (Aug, 2014)
dm3 UCSC Insect D. melanogaster (Fruit fly) Drosophila melanogaster BDGP R5/dm3 (Apr, 2006)
droAna2 UCSC Insect D. ananassae (Fruit fly) Drosophila ananassae Agencourt prelim/droAna2 (Aug, 2005)
droEre1 UCSC Insect D. erecta (Fruit fly) Drosophila erecta Agencourt prelim/droEre1 (Aug, 2005)
droGri1 UCSC Insect D. grimshawi (Fruit fly) Drosophila grimshawi Agencourt prelim/droGri1 (Aug, 2005)
droMoj2 UCSC Insect D. mojavensis (Fruit fly) Drosophila mojavensis Agencourt prelim/droMoj2 (Aug, 2005)
droPer1 UCSC Insect D. persimilis (Fruit fly) Drosophila persimilis Broad/droPer1 (Oct, 2005)
dp3 UCSC Insect D. pseudoobscura (Fruit fly) Drosophila pseudoobscura FlyBase 1.03/dp3 (Nov, 2004)
droSec1 UCSC Insect D. sechellia (Fruit fly) Drosophila sechellia Broad/droSec1 (Oct, 2005)
droSim1 UCSC Insect D. simulans (Fruit fly) Drosophila simulans WUGSC mosaic 1.0/droSim1 (Apr, 2005)
droVir2 UCSC Insect D. virilis (Fruit fly) Drosophila virilis Agencourt prelim/droVir2 (Aug, 2005)
droYak2 UCSC Insect D. yakuba (Fruit fly) Drosophila yakuba WUGSC 7.1/droYak2 (Nov, 2005)
caePb2 UCSC Nematode C. brenneri (Nematode worm) Caenorhabditis brenneri WUGSC 6.0.1/caePb2 (Feb, 2008)
cb3 UCSC Nematode C. briggsae (Nematode worm) Caenorhabditis briggsae WUGSC 1.0/cb3 (Jan, 2007)
ce10 UCSC Nematode C. elegans (Nematode worm) Caenorhabditis elegans WS220/ce10 (Oct, 2010)
caeJap1 UCSC Nematode C. japonica (Nematode worm) Caenorhabditis japonica WUGSC 3.0.2/caeJap1 (Mar, 2008)
caeRem3 UCSC Nematode C. remanei (Nematode worm) Caenorhabditis remanei WUGSC 15.0.1/caeRem3 (May, 2007)
priPac1 UCSC Nematode P. pacificus (Parasitic nematode) Pristionchus pacificus WUGSC 5.0/priPac1 (Feb, 2007)
sacCer3 UCSC Other Budding yeast Saccharomyces cerevisiae SacCer_Apr2011/sacCer3 (Apr, 2011)
aplCal1 UCSC Other Sea hare Aplysia californica Broad 2.0/aplCal1 (Sep, 2008)
eboVir3 UCSC Viruses Ebola virus Filoviridae ebolavirus Sierra Leone G3683/KM034562.1/eboVir3 (Jun, 2014)
OryAfe1.0 Ensembl Mammal Aardvark Orycteropus afer OryAfe1.0 (May, 2012)
PoeFor_5.1.2 Ensembl Vertebrate Amazon molly Poecilia formosa Poecilia_formosa-5.1.2 (Oct, 2013)
CSAV2.0 Ensembl Deuterostome Pacific transparent sea squirt Ciona savignyi CSAV 2.0 (Oct, 2005)
AstMex102 Ensembl Vertebrate Blind cave fish Astyanax mexicanus AstMex102 (Apr, 2013)
PelSin_1.0 Ensembl Vertebrate Chinese softshell turtle Pelodiscus sinensis PelSin_1.0 (Oct, 2011)
MacFas5.0 Ensembl Mammal Crab-eating macaque Macaca fascicularis MacFas5.0 (Jun, 2013)
BGI_duck_1.0 Ensembl Vertebrate Duck Anas platyrhynchos BGI_duck_1.0 (Apr, 2013)
FicAlb_1.4 Ensembl Vertebrate Flycatcher Ficedula albicollis FicAlb_1.4 (Jan, 2012)
Pham Ensembl Mammal Hamadryas baboon Papio hamadryas Pham (Nov, 2008)
Xipmac4.4.2 Ensembl Vertebrate Platyfish Xiphophorus maculatus Xipmac4.4.2 (Jan, 2012)
MicOch1.0 Ensembl Mammal Prairie vole Microtus ochrogaster MicOch1.0 (Nov, 2012)
PhyMac_2.0.2 Ensembl Mammal Sperm whale Physeter macrocephalus PhyMac_2.0.2 (Sep, 2013)
LepOcu1 Ensembl Vertebrate Spotted gar Lepisosteus oculatus LepOcu1 (Dec, 2011)
ChlSab1.1 Ensembl Mammal Green monkey Chlorocebus sabaeus ChlSab1.1 (Mar, 2014)
macaque_CE_1 Mammal Crab-eating macaque Macaca fascicularis CE_1.0 (Jul, 2011)
MesAur1.0 Mammal Golden hamster Mesocricetus auratus MesAur1.0 (Mar, 2013)
Xenla9 Xenbase Vertebrate African clawed frog Xenopus laevis XenBase/JGI 9.1
Xenla7 Xenbase Vertebrate African clawed frog Xenopus laevis JGI 7.1/Xenla7 (Dec, 2013)
Xentr9 Xenbase Vertebrate Western clawed frog Xenopus tropicalis XenBase/JGI 9.0
Xentr8 Xenbase Vertebrate Western clawed frog Xenopus tropicalis XenBase/JGI 8.0
Xentr7 Xenbase Vertebrate Western clawed frog Xenopus tropicalis XenBase/JGI 7.1
xenTro3 UCSC Vertebrate Western clawed frog Xenopus tropicalis JGI 4.2/xenTro3 (Nov, 2009)
Acyr_2.0 EnsemblMetazoa Insect Pea aphid Acyrthosiphon pisum Acyr_2.0 (Jun, 2010)
AaegL5 VectorBase Insect Yellow fever mosquito Aedes aegypti AaegL5 (Jun, 2017)
AaegL3 EnsemblMetazoa Insect Yellow fever mosquito Aedes aegypti AaegL3 (Dec, 2013)
AaloF1 VectorBase Insect Asian tiger mosquito, Forest mosquito Aedes albopictus AaloF1 (Nov, 2015)
Aqu1 EnsemblMetazoa Metazoa Sponge Amphimedon queenslandica Aqu1 (Oct, 2010)
AdarC3 EnsemblMetazoa Insect American malaria mosquito Anopheles darlingi AdarC3 (Jan, 2014)
Aros_1.0 NCBI Insect Turnip sawfly, Coleseed sawfly Athalia rosae Aros_1.0 (Mar, 2013)
Attacep1.0 EnsemblMetazoa Insect Leafcutter ant Atta cephalotes Attacep1.0 (Jul, 2012)
B_malayi_3.0 EnsemblMetazoa Nematode Filarial nematode worm Brugia malayi B_malayi-3.0 (Dec, 2012)
Capte_v1.0 EnsemblMetazoa Metazoa Polychaete worm Capitella teleta Capitella teleta v1.0 (Dec, 2012)
oyster_v9 EnsemblMetazoa Metazoa Pacific oyster Crassostrea gigas oyster_v9 (Sep, 2012)
CpipJ2 EnsemblMetazoa Insect Southern house mosquito Culex quinquefasciatus CpipJ2 (Jan, 2007)
DanPle_1.0 EnsemblMetazoa Insect Monarch butterfly Danaus plexippus DanPle_1.0 (Nov, 2011)
Dappu_V1.0 EnsemblMetazoa Metazoa Water flea Daphnia pulex V1.0 (Feb, 2011)
DendPond_1.0 EnsemblMetazoa Insect Mountain pine beetle Dendroctonus ponderosae DendPond_male_1.0 (Apr, 2013)
dwil_caf1 EnsemblMetazoa Insect D. willistoni (Fruit fly) Drosophila willistoni dwil_caf1 (Jul, 2008)
Hmel1 EnsemblMetazoa Insect Postman butterfly Heliconius melpomene Hmel1 (Feb, 2012)
Helro1 EnsemblMetazoa Metazoa Californian leech Helobdella robusta Helro1 (Dec, 2012)
IscaW1 EnsemblMetazoa Metazoa Black-legged tick Ixodes scapularis IscaW1 (Aug, 2007)
Loa_loa_V3 EnsemblMetazoa Nematode Eye worm Loa loa Loa_loa_V3 (Jan, 2010)
Lotgi1 EnsemblMetazoa Metazoa Giant owl limpet Lottia gigantea Lotgi1 (Jan, 2013)
Msca1 EnsemblMetazoa Insect Humpbacked fly Megaselia scalaris Msca1 (Feb, 2013)
MelCinx1.0 EnsemblMetazoa Insect Glanville fritillary Melitaea cinxia MelCinx1.0 (Jul, 2014)
MneLei EnsemblMetazoa Metazoa Sea walnut Mnemiopsis leidyi MneLei_Aug2011 (Sep, 2011)
Nvit_2.1 EnsemblMetazoa Insect Parasitic wasp Nasonia vitripennis Nvit_2.1 (Nov, 2012)
ASM20922v1 EnsemblMetazoa Metazoa Starlet sea anemone Nematostella vectensis ASM20922v1 (Sep, 2007)
Cameroon_v3 EnsemblMetazoa Nematode O. volvulus (Parasitic nematode) Onchocerca volvulus Cameroon_v3 (Nov, 2013)
PhumU2 EnsemblMetazoa Insect Body louse Pediculus humanus PhumU2 (Nov, 2008)
RproC1 EnsemblMetazoa Insect Triatomid bug Rhodnius prolixus RproC1 (Dec, 2010)
ASM23792v2 EnsemblMetazoa Metazoa Blood fluke Schistosoma mansoni ASM23792v2 (Apr, 2012)
Si_gnG EnsemblMetazoa Insect Red imported fire ant Solenopsis invicta Si_gnG (Feb, 2011)
Smar1 EnsemblMetazoa Metazoa European centipede Strigamia maritima Smar1 (Feb, 2013)
ASM23943v1 EnsemblMetazoa Metazoa Two-spotted spider mite Tetranychus urticae ASM23943v1 (Nov, 2011)
Tcas3 EnsemblMetazoa Insect Red flour beetle Tribolium castaneum Tcas3 (Feb, 2010)
Tspiralis1 EnsemblMetazoa Nematode Trichina worm Trichinella spiralis Tspiralis1 (Mar, 2011)
ASM15027v1 EnsemblMetazoa Metazoa T. adhaerens Trichoplax adhaerens ASM15027v1 (Aug, 2006)
ZooNev1.0 EnsemblMetazoa Insect Dampwood termite Zootermopsis nevadensis ZooNev1.0 (Jun, 2014)
Bomo_silkbase SilkBase Insect Silkworm Bombyx mori SilkBase assembly (Nov, 2016)
ASM15162v1 EnsemblMetazoa Insect Silkworm Bombyx mori ASM15162v1 (Feb, 2013)
bmor1 Ensembl Insect Silkworm Bombyx mori Bmor1 (Apr, 2008)
h7 NCBI Metazoa Hydra Hydra vulgaris h7 (Aug, 2008)
Hydra_RP_1.0 NCBI Metazoa Hydra Hydra vulgaris Hydra_RP_1.0 (Oct, 2009)
Tetth TGD Ciliophora T. thermophila Tetrahymena thermophila Tetrahymena thermophila (Jun, 2014)
Tetbo TGD Ciliophora T. borealis Tetrahymena borealis Tetrahymena borealis (Oct, 2012)
Tetel TGD Ciliophora T. elliotti Tetrahymena elliotti Tetrahymena elliotti (Oct, 2012)
Tetma TGD Ciliophora T. malaccensis Tetrahymena malaccensis Tetrahymena malaccensis (Oct, 2012)
img1 IchDB Ciliophora Ciliate Ichthyophthirius multifiliis Ichthyophthirius multifiliis macronuclear genome
stylo StyloDB Ciliophora Ciliate Stylonychia lemnae Stylonychia lemnae macronuclear genome
oxy OxyDB Ciliophora Ciliate Oxytricha trifallax Oxytricha trifallax macronuclear genome
oxymic OxyDB Ciliophora Ciliate Oxytricha trifallax Oxytricha trifallax micronuclear genome
YOKOZUNA-1 Tardigrada Tardigrade (Water bear) Ramazzottius variornatus YOKOZUNA-1 (Sep, 2016)
ASM34733v1 EnsemblPlants Plant Tausch's goatgrass Aegilops tauschii ASM34733v1 (Dec, 2013)
AMTR1.0 EnsemblPlants Plant A. trichopoda Amborella trichopoda AMTR1.0 (Jan, 2014)
Araly_v.1.0 EnsemblPlants Plant Lyre-leaved rock-cress Arabidopsis lyrata v.1.0 (Dec, 2008)
TAIR10_en EnsemblPlants Plant Thale cress Arabidopsis thaliana TAIR10 (Sep, 2010)
Bradi_v1.0 EnsemblPlants Plant Purple false brome Brachypodium distachyon v1.0 (Jan, 2009)
Braol_v2.1 EnsemblPlants Plant Wild cabbage Brassica oleracea v2.1
Brapa_v1.5 Plant Chinese cabbage Brassica rapa ssp. pekinensis v1.5 (May, 2013)
IVFCAASv1 EnsemblPlants Plant Chinese cabbage Brassica rapa ssp. pekinensis IVFCAASv1 (Aug, 2009)
Chlre_v3.1 EnsemblPlants Plant Green algae Chlamydomonas reinhardtii v3.1 (Nov, 2007)
ASM9120v1 EnsemblPlants Plant Red alga Cyanidioschyzon merolae ASM9120v1 (Nov, 2008)
Soybn_V2.0 EnsemblPlants Plant Soybean Glycine max v2.0 (Nov, 2015)
Soybn_V1.0 EnsemblPlants Plant Soybean Glycine max V1.0 (Jan, 2010)
Horvu_v1 EnsemblPlants Plant Barley Hordeum vulgare 082214v1 (Mar, 2012)
Lperr_V1.4 EnsemblPlants Plant L. perrieri Leersia perrieri Lperr_V1.4 (Mar, 2014)
MedtrA17_4.0 EnsemblPlants Plant Barrel medic Medicago truncatula str. A17 MedtrA17_4.0 (Jun, 2014)
MA1 EnsemblPlants Plant Banana Musa acuminata MA1 (Aug, 2012)
Obart_v1.0 EnsemblPlants Plant African wild rice Oryza barthii Obart_v1.0 (Apr, 2014)
Orybr_v1.4b EnsemblPlants Plant African wild rice Oryza brachyantha Oryza_brachyantha.v1.4b (May, 2011)
AGI1.1 EnsemblPlants Plant African wild rice Oryza glaberrima AGI1.1 (May, 2011)
Orygl EnsemblPlants Plant Brazilian wild rice Oryza glumaepatula ALNU02000000 (Aug, 2013)
Orylo_v0117 EnsemblPlants Plant Longstamen rice Oryza longistaminata v0117-2013Aug (Aug, 2013)
Oryme_v1.3 EnsemblPlants Plant Australian wild rice Oryza meridionalis Oryza_meridionalis_v1.3 (Oct, 2014)
Oryni EnsemblPlants Plant Indian wild rice Oryza nivara AWHD00000000 (Aug, 2013)
Orypu EnsemblPlants Plant Red rice Oryza punctata AVCL00000000 (Aug, 2013)
PRJEB4137 EnsemblPlants Plant Brownbeard rice Oryza rufipogon PRJEB4137 (Aug, 2013)
ASM465v1 EnsemblPlants Plant Rice (Indica) Oryza sativa ssp. indica ASM465v1 (Jan, 2005)
ASM9206v1 EnsemblPlants Plant O. lucimarinus Ostreococcus lucimarinus ASM9206v1 (Jan, 2011)
ASM242v1 EnsemblPlants Plant Moss Physcomitrella patens ASM242v1 (Jul, 2006)
Poptr_JGI2.0 EnsemblPlants Plant Western balsam poplar Populus trichocarpa JGI2.0 (Jan, 2010)
Prupe1_0 EnsemblPlants Plant Peach Prunus persica Prupe1_0 (Mar, 2013)
Selml_v1.0 EnsemblPlants Plant Spikemoss Selaginella moellendorffii v1.0 (May, 2011)
Setit_JGIv2.0 EnsemblPlants Plant Foxtail millet Setaria italica JGIv2.0 (Jan, 2012)
SL3.0 Plant Tomato Solanum lycopersicum SL3.00 (Feb, 2017)
SL2.50 EnsemblPlants Plant Tomato Solanum lycopersicum str. Heinz 1706 SL2.50 (Oct, 2014)
SL2.4 Plant Tomato Solanum lycopersicum SL2.40 (Jan, 2011)
SME_r2.5.1 Plant Eggplant Solanum melongena r2.5.1
SolTub_3.0 EnsemblPlants Plant Potato Solanum tuberosum SolTub_3.0 (May, 2011)
Sorbi3 EnsemblPlants Plant Sorghum Sorghum bicolor NCBIv3 (Jun, 2017)
Sorbi1 EnsemblPlants Plant Sorghum Sorghum bicolor Sorbi1 (Dec, 2007)
Thecc_20110822 EnsemblPlants Plant Cacao Theobroma cacao Theobroma_cacao_20110822 (May, 2014)
IWGSC1.0 EnsemblPlants Plant Wheat Triticum aestivum IWGSC1.0+popseq (Nov, 2014)
ASM34745v1 EnsemblPlants Plant Red wild einkorn Triticum urartu ASM34745v1 (Apr, 2013)
IGGP_12x EnsemblPlants Plant Grape Vitis vinifera IGGP_12x (Jun, 2011)
AGPv4 EnsemblPlants Plant Maize, Corn Zea mays AGPv4 (Mar, 2016)
AGPv3 EnsemblPlants Plant Maize, Corn Zea mays AGPv3 (Apr, 2013)
Ppatens_251_v3 Phytozome Plant Moss Physcomitrella patens v3.0 (Oct, 2007)
Smoellendorffii_91_v1 Phytozome Plant Spikemoss Selaginella moellendorffii v1.0 (Dec, 2007)
Creinhardtii_281_v5_5 Phytozome Plant Green algae Chlamydomonas reinhardtii v5.5 (May, 2014)
Olucimarinus_231_v2 Phytozome Plant O. lucimarinus Ostreococcus lucimarinus v2.0 (Jan, 2011)
Cgrandiflora_v1 Phytozome Plant C. grandiflora Capsella grandiflora v1.1
Crubella_v1 Phytozome Plant Red shepherd's purse Capsella rubella v1.0
Zunla-1_v2.0 Plant Pepper Capsicum annuum release 2.0
Chiltepin_v2.0 Plant Pepper Capsicum annuum var. glabriusculum release 2.0
Cpapaya_r.Dec2008 Phytozome Plant Papaya Carica papaya ASGPBv0.4
WCG_v1 Plant Watermelon Citrullus lanatus subsp. vulgaris v1
W97103_v1 Plant Watermelon Citrullus lanatus subsp. vulgaris v1
Cclementina_v1 Phytozome Plant Clementine Citrus clementina v1.0
Csinensis_v1 Phytozome Plant Sweet orange Citrus sinensis v1.1
CsubellipsoideaC169_v2.0 Phytozome Plant C. subellipsoidea Coccomyxa subellipsoidea v2.0
Ccanephora_1.0 Plant Coffee Coffea canephora v1.0
CM3.6.1 Plant Melon Cucumis melo v3.6.1 (Jul, 2017)
CM3.5.1 Plant Melon Cucumis melo v3.5.1 (Oct, 2013)
PI183967 Plant Cucumber (PI183967) Cucumis sativus PI183967 (Apr, 2013)
ChineseLong_v2 Plant Cucumber (Chinese long) Cucumis sativus v2
Csativus_Gy14 Plant Cucumber Cucumis sativus v1
Csativus_v1 Phytozome Plant Cucumber Cucumis sativus v1.0
Cmo_v1 Plant Pumpkin, Squash Cucurbita moschata v1
Cp4.1 Plant Zucchini Cucurbita pepo subsp. pepo v4.1
Dcarota_v2.0 Phytozome Plant Carrot Daucus carota v2.0
Egrandis_v2.0 Phytozome Plant Eucalyptus Eucalyptus grandis v2.0
fragaria_vesca_v2.0.a1 Plant Strawberry Fragaria vesca v2.0.a1 (Dec, 2014)
Fvesca_v1.1 Phytozome Plant Strawberry Fragaria vesca v1.1
Graimondii_v2.0 Phytozome Plant Cotton Gossypium raimondii v2.1
HanXRQr1.0 Plant Sunflower Helianthus annuus HanXRQr1.0 (Dec, 2015)
Lusitatissimum_BGIv1.0 Phytozome Plant Flax Linum usitatissimum v1.0
malus_x_domestica_v1.0p Plant Apple Malus domestica v1.0p (Aug, 2012)
Mdomestica_v1.0 Phytozome Plant Apple Malus domestica v1.0
Mesculenta_v6 Phytozome Plant Cassava Manihot esculenta v6.1
MpusillaCCMP1545_v3.0 Phytozome Plant Picoplanktonic green alga Micromonas pusilla v3.0
MpusillaRCC299_v3.0 Phytozome Plant Picoplanktonic green alga Micromonas pusilla v3.0
Mguttatus_v2.0 Phytozome Plant Monkey flower Mimulus guttatus v2.0
Ppersica_v2.0 Phytozome Plant Peach Prunus persica v2.1
Rcommunis_TIGR.0.1 Phytozome Plant Castor bean Ricinus communis v0.1
Spolyrhiza_v1 Phytozome Plant Giant duckweed Spirodela polyrhiza v2
Vcarteri_v2 Phytozome Plant Green alga Volvox carteri v2.0
Ptrichocarpa_v3.0 Phytozome Plant Western balsam poplar Populus trichocarpa v3.0
TAIR10 Plant Thale cress Arabidopsis thaliana TAIR10 (Nov, 2010)
rice RAP-DB Plant Rice (Japonica) Oryza sativa ssp. japonica Os-Nipponbare-Reference-IRGSP-1.0 (Oct, 2011)
sorBic Plant Sorghum Sorghum bicolor v2.1 (May, 2013)
Brana_v4.1 Genoscope Plant Rapeseed Brassica napus Genoscope v4.1 (Aug, 2014)
lotus_r3.0 Kazusa Plant Japanese trefoil Lotus japonicus build 3.0 (Aug, 2015)
BX Plant Tobacco (BX) Nicotiana tabacum Ntab-BX (2014)
Niben_v1.0.1 Plant Tobacco Nicotiana benthamiana v1.0.1 (Jul, 2014)
adzuki_ver3 Plant Adzuki bean Vigna angularis ver3 (Nov, 2011)
RSA_r1.0 Kazusa Plant Radish Raphanus sativus RSA_r1.0 (May, 2014)
asagao Plant Japanese morning glory Ipomoea nil
(Pharbitis nil)
Tokyo Kokei Standard; TKS (Sep, 2016)
A_chinensis_Hongyang Plant Golden kiwi, Kiwifruit Actinidia chinensis Actinidia chinensis genome
Mpolymorpha_3.1 Plant Liverwort Marchantia polymorpha JGI 3.1
pombe EnsemblFungi Fungi Fission yeast (972h-) Schizosaccharomyces pombe ASM294v2 (Nov, 2007)
MG8 EnsemblFungi Fungi Rice blast fungus (70-15) Magnaporthe oryzae MG8 (Sep, 2011)
ASM644v2 EnsemblFungi Fungi Marine yeast (CBS767) Debaryomyces hansenii ASM644v2 (Feb, 2015)
ASM251v1 EnsemblFungi Fungi Kluyveromyces yeast Kluyveromyces lactis ASM251v1 (Feb, 2015)
KM1777_03 EnsemblFungi Fungi Kluyveromyces yeast Kluyveromyces marxianus KM1777_03 (Oct, 2014)
PicPas_Mar2011 EnsemblFungi Fungi Methylotrophic yeast (CBS 7435) Komagataella phaffii
(Pichia pastoris)
PicPas_Mar2011 (Oct, 2016)
ASM252v1 EnsemblFungi Fungi Oleaginous yeast Yarrowia lipolytica ASM252v1 (May, 2012)
RR EnsemblFungi Fungi Wheat head blight fungus Fusarium graminearum
(Gibberella zeae)
RR (Nov, 2014)
RHOziaDV1.0 NCBI Fungi Oleaginous yeast (NP11) Rhodotorula toruloides RHOziaDV1.0 (Apr, 2013)
ASM24337v1 EnsemblFungi Fungi Torulaspora yeast Torulaspora delbrueckii ASM24337v1 (Feb, 2015)
A_oryzae_RIB40 AspGD Fungi A. oryzae Aspergillus oryzae s01-m09-r03 (Oct, 2015)
A_nidulans_FGSC_A4 AspGD Fungi A. nidulans (FGSC A4) Aspergillus nidulans
(Emericella nidulans)
s10-m04-r06 (Apr, 2016)
A_fumigatus_Af293 AspGD Fungi A. fumigatus (Af293) Aspergillus fumigatus
(Neosartorya fumigata)
s03-m05-r06 (Apr, 2016)
C_glabrata_CBS138 CGD Fungi C. glabrata (CBS138) Candida glabrata
(Torulopsis glabrata)
s02-m07-r08 (Jun, 2016)
C_albicans_SC5314 CGD Fungi C. albicans (SC5314) Candida albicans Assembly 21, A21-s02-m09-r10 (Feb, 2016)
JCVI_PMFA1_2.0 NCBI Fungi P. marneffei (ATCC 18224) Penicillium marneffei
(Talaromyces marneffei)
JCVI-PMFA1-2.0 (Oct, 2008)
CC3 EnsemblFungi Fungi Inky cap fungus Coprinopsis cinerea
(Hormographiella aspergillata)
CC3 (Aug, 2014)
ASM15095v2 EnsemblProtists Bacillariophyta Diatom Phaeodactylum tricornutum ASM15095v2 (Feb, 2010)
ASM14940v2 EnsemblProtists Bacillariophyta Diatom Thalassiosira pseudonana ASM14940v2 (May, 2014)
GCA_003118565.1 NCBI Vertebrate Madagascar ground gecko Paroedura picta Ppicta_assembly_v1 (Mar, 2018)
AspL_2604 EnsemblFungi Fungi A. luchuensis Aspergillus luchuensis AspL_2604
Akaw_assembly01 NCBI Fungi A. kawachii Aspergillus kawachii IFO 4308 (Nov, 2011)
GCA_000009725.1 CyanoBase Cyanobacteria Synechocystis sp. PCC 6803 Synechocystis sp. PCC 6803 GCA_000009725.1
GCA_000009705.1 CyanoBase Cyanobacteria Nostoc sp. PCC 7120 Nostoc sp. PCC 7120 GCA_000009705.1
GCA_000011345.1 CyanoBase Cyanobacteria Thermosynechococcus elongatus BP-1 Thermosynechococcus elongatus BP-1 GCA_000011345.1
GCA_000010625.1 CyanoBase Cyanobacteria Microcystis aeruginosa NIES-843 Microcystis aeruginosa NIES-843 GCA_000010625.1
GCA_000011385.1 CyanoBase Cyanobacteria Gloeobacter violaceus PCC 7421 Gloeobacter violaceus PCC 7421 GCA_000011385.1
GCA_000006985.1 CyanoBase Chlorobi Chlorobium tepidum TLS Chlorobium tepidum TLS GCA_000006985.1
GCA_000007925.1 CyanoBase Cyanobacteria Prochlorococcus marinus
subsp. marinus str. CCMP1375
Prochlorococcus marinus
subsp. marinus str. CCMP1375
GCA_000010065.1 CyanoBase Cyanobacteria Synechococcus elongatus PCC 6301 Synechococcus elongatus PCC 6301 GCA_000010065.1
GCA_000011465.1 CyanoBase Cyanobacteria Prochlorococcus marinus
subsp. pastoris str. CCMP1986
Prochlorococcus marinus
subsp. pastoris str. CCMP1986
GCA_000011485.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9313 Prochlorococcus marinus str. MIT 9313 GCA_000011485.1
GCA_000012465.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. NATL2A Prochlorococcus marinus str. NATL2A GCA_000012465.1
GCA_000012505.1 CyanoBase Cyanobacteria Synechococcus sp. CC9902 Synechococcus sp. CC9902 GCA_000012505.1
GCA_000012525.1 CyanoBase Cyanobacteria Synechococcus elongatus PCC 7942 Synechococcus elongatus PCC 7942 GCA_000012525.1
GCA_000012625.1 CyanoBase Cyanobacteria Synechococcus sp. CC9605 Synechococcus sp. CC9605 GCA_000012625.1
GCA_000012645.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9312 Prochlorococcus marinus str. MIT 9312 GCA_000012645.1
GCA_000013205.1 CyanoBase Cyanobacteria Synechococcus sp. JA-3-3Ab Synechococcus sp. JA-3-3Ab GCA_000013205.1
GCA_000013225.1 CyanoBase Cyanobacteria Cyanobacteria bacterium
Yellowstone B-Prime
Cyanobacteria bacterium
Yellowstone B-Prime
GCA_000014265.1 CyanoBase Cyanobacteria Trichodesmium erythraeum IMS101 Trichodesmium erythraeum IMS101 GCA_000014265.1
GCA_000014585.1 CyanoBase Cyanobacteria Synechococcus sp. CC9311 Synechococcus sp. CC9311 GCA_000014585.1
GCA_000015645.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. AS9601 Prochlorococcus marinus str. AS9601 GCA_000015645.1
GCA_000015665.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9515 Prochlorococcus marinus str. MIT 9515 GCA_000015665.1
GCA_000015685.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. NATL1A Prochlorococcus marinus str. NATL1A GCA_000015685.1
GCA_000015705.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9303 Prochlorococcus marinus str. MIT 9303 GCA_000015705.1
GCA_000015965.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9301 Prochlorococcus marinus str. MIT 9301 GCA_000015965.1
GCA_000017845.1 CyanoBase Cyanobacteria Cyanothece sp. ATCC 51142 Cyanothece sp. ATCC 51142 GCA_000017845.1
GCA_000018065.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9215 Prochlorococcus marinus str. MIT 9215 GCA_000018065.1
GCA_000018105.1 CyanoBase Cyanobacteria Acaryochloris marina MBIC11017 Acaryochloris marina MBIC11017 GCA_000018105.1
GCA_000018585.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9211 Prochlorococcus marinus str. MIT 9211 GCA_000018585.1
GCA_000019485.1 CyanoBase Cyanobacteria Synechococcus sp. PCC 7002 Synechococcus sp. PCC 7002 GCA_000019485.1
GCA_000020025.1 CyanoBase Cyanobacteria Nostoc punctiforme PCC 73102 Nostoc punctiforme PCC 73102 GCA_000020025.1
GCA_000021805.1 CyanoBase Cyanobacteria Cyanothece sp. PCC 8801 Cyanothece sp. PCC 8801 GCA_000021805.1
GCA_000021825.1 CyanoBase Cyanobacteria Cyanothece sp. PCC 7424 Cyanothece sp. PCC 7424 GCA_000021825.1
GCA_000022045.1 CyanoBase Cyanobacteria Cyanothece sp. PCC 7425 Cyanothece sp. PCC 7425 GCA_000022045.1
GCA_000024045.1 CyanoBase Cyanobacteria Cyanothece sp. PCC 8802 Cyanothece sp. PCC 8802 GCA_000024045.1
GCA_000025125.1 CyanoBase Cyanobacteria Candidatus Atelocyanobacterium thalassa
isolate ALOHA
Candidatus Atelocyanobacterium thalassa
isolate ALOHA
GCA_000063505.1 CyanoBase Cyanobacteria Synechococcus sp. WH 7803 Synechococcus sp. WH 7803 GCA_000063505.1
GCA_000063525.1 CyanoBase Cyanobacteria Synechococcus sp. RCC307 Synechococcus sp. RCC307 GCA_000063525.1
GCA_000147335.1 CyanoBase Cyanobacteria Cyanothece sp. PCC 7822 Cyanothece sp. PCC 7822 GCA_000147335.1
GCA_000153045.1 CyanoBase Cyanobacteria Synechococcus sp. WH 5701 Synechococcus sp. WH 5701 GCA_000153045.1
GCA_000153065.1 CyanoBase Cyanobacteria Synechococcus sp. RS9917 Synechococcus sp. RS9917 GCA_000153065.1
GCA_000153285.1 CyanoBase Cyanobacteria Synechococcus sp. WH 7805 Synechococcus sp. WH 7805 GCA_000153285.1
GCA_000153805.1 CyanoBase Cyanobacteria Synechococcus sp. BL107 Synechococcus sp. BL107 GCA_000153805.1
GCA_000153825.1 CyanoBase Cyanobacteria Synechococcus sp. RS9916 Synechococcus sp. RS9916 GCA_000153825.1
GCA_000155555.1 CyanoBase Cyanobacteria Coleofasciculus chthonoplastes PCC 7420 Coleofasciculus chthonoplastes PCC 7420 GCA_000155555.1
GCA_000155595.1 CyanoBase Cyanobacteria Synechococcus sp. PCC 7335 Synechococcus sp. PCC 7335 GCA_000155595.1
GCA_000155635.1 CyanoBase Cyanobacteria Cyanobium sp. PCC 7001 Cyanobium sp. PCC 7001 GCA_000155635.1
GCA_000158595.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9202 Prochlorococcus marinus str. MIT 9202 GCA_000158595.1
GCA_000161795.2 CyanoBase Cyanobacteria Synechococcus sp. WH 8109 Synechococcus sp. WH 8109 GCA_000161795.2
GCA_000167195.1 CyanoBase Cyanobacteria Crocosphaera watsonii WH 8501 Crocosphaera watsonii WH 8501 GCA_000167195.1
GCA_000169095.1 CyanoBase Cyanobacteria Lyngbya sp. PCC 8106 Lyngbya sp. PCC 8106 GCA_000169095.1
GCA_000169135.1 CyanoBase Cyanobacteria Nodularia spumigena CCY9414 Nodularia spumigena CCY9414 GCA_000169135.1
GCA_000169335.1 CyanoBase Cyanobacteria Cyanothece sp. CCY0110 Cyanothece sp. CCY0110 GCA_000169335.1
GCA_000173555.1 CyanoBase Cyanobacteria Arthrospira maxima CS-328 Arthrospira maxima CS-328 GCA_000173555.1
GCA_000175415.3 CyanoBase Cyanobacteria Arthrospira platensis str. Paraca Arthrospira platensis str. Paraca GCA_000175415.3
GCA_000175835.1 CyanoBase Cyanobacteria Cylindrospermopsis raciborskii CS-505 Cylindrospermopsis raciborskii CS-505 GCA_000175835.1
GCA_000175855.1 CyanoBase Cyanobacteria Raphidiopsis brookii D9 Raphidiopsis brookii D9 GCA_000175855.1
GCA_000176895.2 CyanoBase Cyanobacteria Arthrospira sp. PCC 8005 Arthrospira sp. PCC 8005 GCA_000176895.2
GCA_000179235.1 CyanoBase Cyanobacteria Synechococcus sp. CB0101 Synechococcus sp. CB0101 GCA_000179235.1
GCA_000179255.1 CyanoBase Cyanobacteria Synechococcus sp. CB0205 Synechococcus sp. CB0205 GCA_000179255.1
GCA_000180455.1 CyanoBase Cyanobacteria Oscillatoria sp. PCC 6506 Oscillatoria sp. PCC 6506 GCA_000180455.1
GCA_000195775.1 CyanoBase Proteobacteria Rhodopseudomonas palustris CGA009 Rhodopseudomonas palustris CGA009 GCA_000195775.1
GCA_000195975.1 CyanoBase Cyanobacteria Synechococcus sp. WH 8102 Synechococcus sp. WH 8102 GCA_000195975.1
GCA_000196515.1 CyanoBase Cyanobacteria Nostoc azollae 0708 Nostoc azollae 0708 GCA_000196515.1
GCA_000204075.1 CyanoBase Cyanobacteria Anabaena variabilis ATCC 29413 Anabaena variabilis ATCC 29413 GCA_000204075.1
GCA_000210375.1 CyanoBase Cyanobacteria Arthrospira platensis NIES-39 Arthrospira platensis NIES-39 GCA_000210375.1
GCA_000211815.1 CyanoBase Cyanobacteria Moorea producens 3L Moorea producens 3L GCA_000211815.1
GCA_000214075.2 CyanoBase Cyanobacteria Microcoleus vaginatus FGP-2 Microcoleus vaginatus FGP-2 GCA_000214075.2
GCA_000218705.1 CyanoBase Cyanobacteria Prochlorococcus marinus bv. HNLC1 Prochlorococcus marinus bv. HNLC1 GCA_000218705.1
GCA_000218745.1 CyanoBase Cyanobacteria Prochlorococcus marinus bv. HNLC2 Prochlorococcus marinus bv. HNLC2 GCA_000218745.1
GCA_000230675.2 CyanoBase Cyanobacteria Synechococcus sp. WH 8016 Synechococcus sp. WH 8016 GCA_000230675.2
GCA_000231365.2 CyanoBase Cyanobacteria Fischerella sp. JSC-11 Fischerella sp. JSC-11 GCA_000231365.2
GCA_000231425.3 CyanoBase Cyanobacteria Cyanothece sp. ATCC 51472 Cyanothece sp. ATCC 51472 GCA_000231425.3
GCA_000235665.2 CyanoBase Cyanobacteria Crocosphaera watsonii WH 0003 Crocosphaera watsonii WH 0003 GCA_000235665.2
GCA_000238775.2 CyanoBase Cyanobacteria Acaryochloris sp. CCMEE 5410 Acaryochloris sp. CCMEE 5410 GCA_000238775.2
GCA_000252425.1 CyanoBase Cyanobacteria Prochloron didemni P2-Fiji Prochloron didemni P2-Fiji GCA_000252425.1
GCA_000252465.1 CyanoBase Cyanobacteria Prochloron didemni P3-Solomon Prochloron didemni P3-Solomon GCA_000252465.1
GCA_000252485.1 CyanoBase Cyanobacteria Prochloron didemni P4-Papua_New_Guinea Prochloron didemni P4-Papua_New_Guinea GCA_000252485.1
GCA_000270265.1 CyanoBase Cyanobacteria Synechocystis sp. PCC 6803 Synechocystis sp. PCC 6803 GCA_000270265.1
GCA_000284135.1 CyanoBase Cyanobacteria Synechocystis sp. PCC 6803 substr. GT-I Synechocystis sp. PCC 6803 substr. GT-I GCA_000284135.1
GCA_000284215.1 CyanoBase Cyanobacteria Synechocystis sp. PCC 6803 substr. PCC-N Synechocystis sp. PCC 6803 substr. PCC-N GCA_000284215.1
GCA_000284455.1 CyanoBase Cyanobacteria Synechocystis sp. PCC 6803 substr. PCC-P Synechocystis sp. PCC 6803 substr. PCC-P GCA_000284455.1
GCA_000291785.1 CyanoBase Cyanobacteria Prochlorococcus sp. W4 Prochlorococcus sp. W4 GCA_000291785.1
GCA_000291805.1 CyanoBase Cyanobacteria Prochlorococcus sp. W7 Prochlorococcus sp. W7 GCA_000291805.1
GCA_000291825.1 CyanoBase Cyanobacteria Prochlorococcus sp. W8 Prochlorococcus sp. W8 GCA_000291825.1
GCA_000291845.1 CyanoBase Cyanobacteria Prochlorococcus sp. W10 Prochlorococcus sp. W10 GCA_000291845.1
GCA_000291865.1 CyanoBase Cyanobacteria Prochlorococcus sp. W6 Prochlorococcus sp. W6 GCA_000291865.1
GCA_000291885.1 CyanoBase Cyanobacteria Prochlorococcus sp. W2 Prochlorococcus sp. W2 GCA_000291885.1
GCA_000291905.1 CyanoBase Cyanobacteria Prochlorococcus sp. W3 Prochlorococcus sp. W3 GCA_000291905.1
GCA_000291925.1 CyanoBase Cyanobacteria Prochlorococcus sp. W9 Prochlorococcus sp. W9 GCA_000291925.1
GCA_000291945.1 CyanoBase Cyanobacteria Prochlorococcus sp. W11 Prochlorococcus sp. W11 GCA_000291945.1
GCA_000291965.1 CyanoBase Cyanobacteria Prochlorococcus sp. W12 Prochlorococcus sp. W12 GCA_000291965.1
GCA_000291985.1 CyanoBase Cyanobacteria Prochlorococcus sp. W5 Prochlorococcus sp. W5 GCA_000291985.1
GCA_000297435.1 CyanoBase Cyanobacteria Microcystis sp. T1-4 Microcystis sp. T1-4 GCA_000297435.1
GCA_000300115.1 CyanoBase Cyanobacteria Tolypothrix sp. PCC 7601 Tolypothrix sp. PCC 7601 GCA_000300115.1
GCA_000307915.1 CyanoBase Cyanobacteria Arthrospira platensis C1 Arthrospira platensis C1 GCA_000307915.1
GCA_000307995.2 CyanoBase Cyanobacteria Microcystis aeruginosa PCC 9432 Microcystis aeruginosa PCC 9432 GCA_000307995.2
GCA_000309385.1 CyanoBase Cyanobacteria Nodosilinea nodulosa PCC 7104 Nodosilinea nodulosa PCC 7104 GCA_000309385.1
GCA_000309945.1 CyanoBase Cyanobacteria Oscillatoriales cyanobacterium JSC-12 Oscillatoriales cyanobacterium JSC-12 GCA_000309945.1
GCA_000312165.1 CyanoBase Cyanobacteria Microcystis aeruginosa PCC 9717 Microcystis aeruginosa PCC 9717 GCA_000312165.1
GCA_000312185.1 CyanoBase Cyanobacteria Microcystis aeruginosa PCC 9443 Microcystis aeruginosa PCC 9443 GCA_000312185.1
GCA_000312205.1 CyanoBase Cyanobacteria Microcystis aeruginosa PCC 7941 Microcystis aeruginosa PCC 7941 GCA_000312205.1
GCA_000312225.1 CyanoBase Cyanobacteria Microcystis aeruginosa PCC 9807 Microcystis aeruginosa PCC 9807 GCA_000312225.1
GCA_000312245.1 CyanoBase Cyanobacteria Microcystis aeruginosa PCC 9808 Microcystis aeruginosa PCC 9808 GCA_000312245.1
GCA_000312265.1 CyanoBase Cyanobacteria Microcystis aeruginosa PCC 9809 Microcystis aeruginosa PCC 9809 GCA_000312265.1
GCA_000312285.1 CyanoBase Cyanobacteria Microcystis aeruginosa PCC 9701 Microcystis aeruginosa PCC 9701 GCA_000312285.1
GCA_000312705.1 CyanoBase Cyanobacteria Anabaena sp. 90 Anabaena sp. 90 GCA_000312705.1
GCA_000312725.1 CyanoBase Cyanobacteria Microcystis aeruginosa PCC 9806 Microcystis aeruginosa PCC 9806 GCA_000312725.1
GCA_000314005.1 CyanoBase Cyanobacteria Spirulina subsalsa PCC 9445 Spirulina subsalsa PCC 9445 GCA_000314005.1
GCA_000315565.1 CyanoBase Cyanobacteria Mastigocladopsis repens PCC 10914 Mastigocladopsis repens PCC 10914 GCA_000315565.1
GCA_000315585.1 CyanoBase Cyanobacteria Fischerella sp. PCC 9339 Fischerella sp. PCC 9339 GCA_000315585.1
GCA_000316115.1 CyanoBase Cyanobacteria Leptolyngbya sp. PCC 7375 Leptolyngbya sp. PCC 7375 GCA_000316115.1
GCA_000316515.1 CyanoBase Cyanobacteria Cyanobium gracile PCC 6307 Cyanobium gracile PCC 6307 GCA_000316515.1
GCA_000316575.1 CyanoBase Cyanobacteria Calothrix sp. PCC 7507 Calothrix sp. PCC 7507 GCA_000316575.1
GCA_000316605.1 CyanoBase Cyanobacteria Leptolyngbya sp. PCC 7376 Leptolyngbya sp. PCC 7376 GCA_000316605.1
GCA_000316625.1 CyanoBase Cyanobacteria Nostoc sp. PCC 7107 Nostoc sp. PCC 7107 GCA_000316625.1
GCA_000316645.1 CyanoBase Cyanobacteria Nostoc sp. PCC 7524 Nostoc sp. PCC 7524 GCA_000316645.1
GCA_000316665.1 CyanoBase Cyanobacteria Rivularia sp. PCC 7116 Rivularia sp. PCC 7116 GCA_000316665.1
GCA_000316685.1 CyanoBase Cyanobacteria Synechococcus sp. PCC 6312 Synechococcus sp. PCC 6312 GCA_000316685.1
GCA_000317025.1 CyanoBase Cyanobacteria Pleurocapsa sp. PCC 7327 Pleurocapsa sp. PCC 7327 GCA_000317025.1
GCA_000317045.1 CyanoBase Cyanobacteria Geitlerinema sp. PCC 7407 Geitlerinema sp. PCC 7407 GCA_000317045.1
GCA_000317065.1 CyanoBase Cyanobacteria Pseudanabaena sp. PCC 7367 Pseudanabaena sp. PCC 7367 GCA_000317065.1
GCA_000317085.1 CyanoBase Cyanobacteria Synechococcus sp. PCC 7502 Synechococcus sp. PCC 7502 GCA_000317085.1
GCA_000317105.1 CyanoBase Cyanobacteria Oscillatoria acuminata PCC 6304 Oscillatoria acuminata PCC 6304 GCA_000317105.1
GCA_000317125.1 CyanoBase Cyanobacteria Chroococcidiopsis thermalis PCC 7203 Chroococcidiopsis thermalis PCC 7203 GCA_000317125.1
GCA_000317145.1 CyanoBase Cyanobacteria Chamaesiphon minutus PCC 6605 Chamaesiphon minutus PCC 6605 GCA_000317145.1
GCA_000317205.1 CyanoBase Cyanobacteria Fischerella muscicola PCC 7414 Fischerella muscicola PCC 7414 GCA_000317205.1
GCA_000317225.1 CyanoBase Cyanobacteria Fischerella thermalis PCC 7521 Fischerella thermalis PCC 7521 GCA_000317225.1
GCA_000317245.1 CyanoBase Cyanobacteria Fischerella muscicola SAG 1427-1 Fischerella muscicola SAG 1427-1 GCA_000317245.1
GCA_000317265.1 CyanoBase Cyanobacteria Chlorogloeopsis fritschii PCC 9212 Chlorogloeopsis fritschii PCC 9212 GCA_000317265.1
GCA_000317285.1 CyanoBase Cyanobacteria Chlorogloeopsis fritschii PCC 6912 Chlorogloeopsis fritschii PCC 6912 GCA_000317285.1
GCA_000317435.1 CyanoBase Cyanobacteria Calothrix sp. PCC 6303 Calothrix sp. PCC 6303 GCA_000317435.1
GCA_000317475.1 CyanoBase Cyanobacteria Oscillatoria nigro-viridis PCC 7112 Oscillatoria nigro-viridis PCC 7112 GCA_000317475.1
GCA_000317495.1 CyanoBase Cyanobacteria Crinalium epipsammum PCC 9333 Crinalium epipsammum PCC 9333 GCA_000317495.1
GCA_000317515.1 CyanoBase Cyanobacteria Microcoleus sp. PCC 7113 Microcoleus sp. PCC 7113 GCA_000317515.1
GCA_000317535.1 CyanoBase Cyanobacteria Cylindrospermum stagnale PCC 7417 Cylindrospermum stagnale PCC 7417 GCA_000317535.1
GCA_000317555.1 CyanoBase Cyanobacteria Gloeocapsa sp. PCC 7428 Gloeocapsa sp. PCC 7428 GCA_000317555.1
GCA_000317575.1 CyanoBase Cyanobacteria Stanieria cyanosphaera PCC 7437 Stanieria cyanosphaera PCC 7437 GCA_000317575.1
GCA_000317615.1 CyanoBase Cyanobacteria Dactylococcopsis salina PCC 8305 Dactylococcopsis salina PCC 8305 GCA_000317615.1
GCA_000317635.1 CyanoBase Cyanobacteria Halothece sp. PCC 7418 Halothece sp. PCC 7418 GCA_000317635.1
GCA_000317655.1 CyanoBase Cyanobacteria Cyanobacterium stanieri PCC 7202 Cyanobacterium stanieri PCC 7202 GCA_000317655.1
GCA_000317675.1 CyanoBase Cyanobacteria Cyanobacterium aponinum PCC 10605 Cyanobacterium aponinum PCC 10605 GCA_000317675.1
GCA_000317695.1 CyanoBase Cyanobacteria Anabaena cylindrica PCC 7122 Anabaena cylindrica PCC 7122 GCA_000317695.1
GCA_000330925.1 CyanoBase Cyanobacteria Microcystis aeruginosa TAIHU98 Microcystis aeruginosa TAIHU98 GCA_000330925.1
GCA_000331305.1 CyanoBase Cyanobacteria Calothrix sp. PCC 7103 Calothrix sp. PCC 7103 GCA_000331305.1
GCA_000332035.1 CyanoBase Cyanobacteria Gloeocapsa sp. PCC 73106 Gloeocapsa sp. PCC 73106 GCA_000332035.1
GCA_000332055.1 CyanoBase Cyanobacteria Xenococcus sp. PCC 7305 Xenococcus sp. PCC 7305 GCA_000332055.1
GCA_000332075.2 CyanoBase Cyanobacteria Synechocystis sp. PCC 7509 Synechocystis sp. PCC 7509 GCA_000332075.2
GCA_000332095.2 CyanoBase Cyanobacteria Leptolyngbya sp. PCC 6406 Leptolyngbya sp. PCC 6406 GCA_000332095.2
GCA_000332135.1 CyanoBase Cyanobacteria Anabaena sp. PCC 7108 Anabaena sp. PCC 7108 GCA_000332135.1
GCA_000332155.1 CyanoBase Cyanobacteria Kamptonema formosum PCC 6407 Kamptonema formosum PCC 6407 GCA_000332155.1
GCA_000332175.1 CyanoBase Cyanobacteria Pseudanabaena sp. PCC 6802 Pseudanabaena sp. PCC 6802 GCA_000332175.1
GCA_000332195.1 CyanoBase Cyanobacteria Pleurocapsa sp. PCC 7319 Pleurocapsa sp. PCC 7319 GCA_000332195.1
GCA_000332215.1 CyanoBase Cyanobacteria Pseudanabaena biceps PCC 7429 Pseudanabaena biceps PCC 7429 GCA_000332215.1
GCA_000332235.1 CyanoBase Cyanobacteria Geminocystis herdmanii PCC 6308 Geminocystis herdmanii PCC 6308 GCA_000332235.1
GCA_000332255.1 CyanoBase Cyanobacteria cyanobacterium PCC 7702 cyanobacterium PCC 7702 GCA_000332255.1
GCA_000332275.1 CyanoBase Cyanobacteria Synechococcus sp. PCC 7336 Synechococcus sp. PCC 7336 GCA_000332275.1
GCA_000332295.1 CyanoBase Cyanobacteria Microchaete sp. PCC 7126 Microchaete sp. PCC 7126 GCA_000332295.1
GCA_000332315.1 CyanoBase Cyanobacteria Prochlorothrix hollandica PCC 9006 Prochlorothrix hollandica PCC 9006 GCA_000332315.1
GCA_000332335.1 CyanoBase Cyanobacteria Oscillatoria sp. PCC 10802 Oscillatoria sp. PCC 10802 GCA_000332335.1
GCA_000332355.1 CyanoBase Cyanobacteria Geitlerinema sp. PCC 7105 Geitlerinema sp. PCC 7105 GCA_000332355.1
GCA_000332585.1 CyanoBase Cyanobacteria Microcystis aeruginosa DIANCHI905 Microcystis aeruginosa DIANCHI905 GCA_000332585.1
GCA_000340565.3 CyanoBase Cyanobacteria Nodularia spumigena CCY9414 Nodularia spumigena CCY9414 GCA_000340565.3
GCA_000340785.1 CyanoBase Cyanobacteria Synechocystis sp. PCC 6803 Synechocystis sp. PCC 6803 GCA_000340785.1
GCA_000341585.2 CyanoBase Cyanobacteria Prochlorothrix hollandica PCC 9006 Prochlorothrix hollandica PCC 9006 GCA_000341585.2
GCA_000346485.1 CyanoBase Cyanobacteria Scytonema hofmanni PCC 7110 Scytonema hofmanni PCC 7110 GCA_000346485.1
GCA_000350105.1 CyanoBase Cyanobacteria Richelia intracellularis HH01 Richelia intracellularis HH01 GCA_000350105.1
GCA_000350125.1 CyanoBase Cyanobacteria Richelia intracellularis HM01 Richelia intracellularis HM01 GCA_000350125.1
GCA_000353285.1 CyanoBase Cyanobacteria Leptolyngbya boryana PCC 6306 Leptolyngbya boryana PCC 6306 GCA_000353285.1
GCA_000380225.1 CyanoBase Cyanobacteria filamentous cyanobacterium ESFC-1 filamentous cyanobacterium ESFC-1 GCA_000380225.1
GCA_000412595.1 CyanoBase Cyanobacteria Microcystis aeruginosa SPC777 Microcystis aeruginosa SPC777 GCA_000412595.1
GCA_000426905.1 CyanoBase Cyanobacteria Dolichospermum circinale AWQC131C Dolichospermum circinale AWQC131C GCA_000426905.1
GCA_000426925.1 CyanoBase Cyanobacteria Dolichospermum circinale AWQC310F Dolichospermum circinale AWQC310F GCA_000426925.1
GCA_000447295.1 CyanoBase Cyanobacteria Fischerella sp. PCC 9431 Fischerella sp. PCC 9431 GCA_000447295.1
GCA_000464665.1 CyanoBase Cyanobacteria Planktothrix agardhii NIVA-CYA 15 Planktothrix agardhii NIVA-CYA 15 GCA_000464665.1
GCA_000464725.1 CyanoBase Cyanobacteria Planktothrix agardhii NIVA-CYA 34 Planktothrix agardhii NIVA-CYA 34 GCA_000464725.1
GCA_000464745.1 CyanoBase Cyanobacteria Planktothrix mougeotii NIVA-CYA 405 Planktothrix mougeotii NIVA-CYA 405 GCA_000464745.1
GCA_000464765.1 CyanoBase Cyanobacteria Planktothrix prolifica NIVA-CYA 406 Planktothrix prolifica NIVA-CYA 406 GCA_000464765.1
GCA_000464785.1 CyanoBase Cyanobacteria Planktothrix rubescens NIVA-CYA 407 Planktothrix rubescens NIVA-CYA 407 GCA_000464785.1
GCA_000464805.1 CyanoBase Cyanobacteria Planktothrix prolifica NIVA-CYA 540 Planktothrix prolifica NIVA-CYA 540 GCA_000464805.1
GCA_000464825.1 CyanoBase Cyanobacteria Planktothrix agardhii NIVA-CYA 56/3 Planktothrix agardhii NIVA-CYA 56/3 GCA_000464825.1
GCA_000464845.1 CyanoBase Cyanobacteria Planktothrix prolifica NIVA-CYA 98 Planktothrix prolifica NIVA-CYA 98 GCA_000464845.1
GCA_000472885.1 CyanoBase Cyanobacteria Mastigocoleus testarum BC008 Mastigocoleus testarum BC008 GCA_000472885.1
GCA_000473895.1 CyanoBase Cyanobacteria Rubidibacter lacunae KORDI 51-2 Rubidibacter lacunae KORDI 51-2 GCA_000473895.1
GCA_000478195.2 CyanoBase Cyanobacteria Lyngbya aestuarii BL J Lyngbya aestuarii BL J GCA_000478195.2
GCA_000478825.2 CyanoBase Cyanobacteria Synechocystis sp. PCC 6714 Synechocystis sp. PCC 6714 GCA_000478825.2
GCA_000482245.1 CyanoBase Cyanobacteria Leptolyngbya sp. Heron Island J Leptolyngbya sp. Heron Island J GCA_000482245.1
GCA_000484535.1 CyanoBase Cyanobacteria Gloeobacter kilaueensis JS1 Gloeobacter kilaueensis JS1 GCA_000484535.1
GCA_000485815.1 CyanoBase Cyanobacteria Synechococcus sp. NKBG15041c Synechococcus sp. NKBG15041c GCA_000485815.1
GCA_000505665.1 CyanoBase Cyanobacteria Thermosynechococcus sp. NK55a Thermosynechococcus sp. NK55a GCA_000505665.1
GCA_000515235.1 CyanoBase Cyanobacteria Synechococcus sp. CC9616 Synechococcus sp. CC9616 GCA_000515235.1
GCA_000517105.1 CyanoBase Cyanobacteria Fischerella sp. PCC 9605 Fischerella sp. PCC 9605 GCA_000517105.1
GCA_000521175.1 CyanoBase Cyanobacteria Aphanizomenon flos-aquae NIES-81 Aphanizomenon flos-aquae NIES-81 GCA_000521175.1
GCA_000582685.1 CyanoBase Cyanobacteria Scytonema hofmanni UTEX 2349 Scytonema hofmanni UTEX 2349 GCA_000582685.1
GCA_000586015.1 CyanoBase Cyanobacteria Candidatus Synechococcus spongiarum SH4 Candidatus Synechococcus spongiarum SH4 GCA_000586015.1
GCA_000599945.1 CyanoBase Cyanobacteria Microcystis aeruginosa PCC 7005 Microcystis aeruginosa PCC 7005 GCA_000599945.1
GCA_000613065.1 CyanoBase Cyanobacteria Richelia intracellularis Richelia intracellularis GCA_000613065.1
GCA_000633975.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_526B17 Prochlorococcus sp. scB241_526B17 GCA_000633975.1
GCA_000633995.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_526K3 Prochlorococcus sp. scB241_526K3 GCA_000633995.1
GCA_000634015.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_526N9 Prochlorococcus sp. scB241_526N9 GCA_000634015.1
GCA_000634035.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_527E14 Prochlorococcus sp. scB241_527E14 GCA_000634035.1
GCA_000634055.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_527N11 Prochlorococcus sp. scB241_527N11 GCA_000634055.1
GCA_000634075.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_528J14 Prochlorococcus sp. scB241_528J14 GCA_000634075.1
GCA_000634095.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_528J8 Prochlorococcus sp. scB241_528J8 GCA_000634095.1
GCA_000634115.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_528O2 Prochlorococcus sp. scB241_528O2 GCA_000634115.1
GCA_000634135.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_528P14 Prochlorococcus sp. scB241_528P14 GCA_000634135.1
GCA_000634155.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_529C4 Prochlorococcus sp. scB241_529C4 GCA_000634155.1
GCA_000634175.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_529D18 Prochlorococcus sp. scB241_529D18 GCA_000634175.1
GCA_000634195.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_495D8 Prochlorococcus sp. scB243_495D8 GCA_000634195.1
GCA_000634215.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_495L20 Prochlorococcus sp. scB243_495L20 GCA_000634215.1
GCA_000634235.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_495N16 Prochlorococcus sp. scB243_495N16 GCA_000634235.1
GCA_000634255.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_496A2 Prochlorococcus sp. scB243_496A2 GCA_000634255.1
GCA_000634275.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_497J18 Prochlorococcus sp. scB243_497J18 GCA_000634275.1
GCA_000634295.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_498A3 Prochlorococcus sp. scB243_498A3 GCA_000634295.1
GCA_000634315.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_498J20 Prochlorococcus sp. scB243_498J20 GCA_000634315.1
GCA_000634335.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_498N4 Prochlorococcus sp. scB243_498N4 GCA_000634335.1
GCA_000634355.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_498N8 Prochlorococcus sp. scB243_498N8 GCA_000634355.1
GCA_000634375.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_518A17 Prochlorococcus sp. scB245a_518A17 GCA_000634375.1
GCA_000634395.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_518D8 Prochlorococcus sp. scB245a_518D8 GCA_000634395.1
GCA_000634415.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_519A13 Prochlorococcus sp. scB245a_519A13 GCA_000634415.1
GCA_000634435.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_519B7 Prochlorococcus sp. scB245a_519B7 GCA_000634435.1
GCA_000634455.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_519O21 Prochlorococcus sp. scB245a_519O21 GCA_000634455.1
GCA_000634475.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_520B18 Prochlorococcus sp. scB245a_520B18 GCA_000634475.1
GCA_000634495.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_520D2 Prochlorococcus sp. scB245a_520D2 GCA_000634495.1
GCA_000634515.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_520K10 Prochlorococcus sp. scB245a_520K10 GCA_000634515.1
GCA_000634535.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_520M11 Prochlorococcus sp. scB245a_520M11 GCA_000634535.1
GCA_000634555.2 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_521A19 Prochlorococcus sp. scB245a_521A19 GCA_000634555.2
GCA_000634575.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_521N3 Prochlorococcus sp. scB245a_521N3 GCA_000634575.1
GCA_000634595.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_521O23 Prochlorococcus sp. scB245a_521O23 GCA_000634595.1
GCA_000634615.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_526B19 Prochlorococcus sp. scB241_526B19 GCA_000634615.1
GCA_000634635.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_526B22 Prochlorococcus sp. scB241_526B22 GCA_000634635.1
GCA_000634655.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_526N5 Prochlorococcus sp. scB241_526N5 GCA_000634655.1
GCA_000634675.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_527E15 Prochlorococcus sp. scB241_527E15 GCA_000634675.1
GCA_000634695.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_527L15 Prochlorococcus sp. scB241_527L15 GCA_000634695.1
GCA_000634715.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_528K19 Prochlorococcus sp. scB241_528K19 GCA_000634715.1
GCA_000634735.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_528N17 Prochlorococcus sp. scB241_528N17 GCA_000634735.1
GCA_000634755.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_528N20 Prochlorococcus sp. scB241_528N20 GCA_000634755.1
GCA_000634775.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_528N8 Prochlorococcus sp. scB241_528N8 GCA_000634775.1
GCA_000634795.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_529J15 Prochlorococcus sp. scB241_529J15 GCA_000634795.1
GCA_000634815.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_495G23 Prochlorococcus sp. scB243_495G23 GCA_000634815.1
GCA_000634835.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_495I8 Prochlorococcus sp. scB243_495I8 GCA_000634835.1
GCA_000634855.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_495N4 Prochlorococcus sp. scB243_495N4 GCA_000634855.1
GCA_000634875.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_495P20 Prochlorococcus sp. scB243_495P20 GCA_000634875.1
GCA_000634895.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_496E10 Prochlorococcus sp. scB243_496E10 GCA_000634895.1
GCA_000634915.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_496G15 Prochlorococcus sp. scB243_496G15 GCA_000634915.1
GCA_000634935.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_497I20 Prochlorococcus sp. scB243_497I20 GCA_000634935.1
GCA_000634955.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_497N18 Prochlorococcus sp. scB243_497N18 GCA_000634955.1
GCA_000634975.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_498B22 Prochlorococcus sp. scB243_498B22 GCA_000634975.1
GCA_000634995.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_498C16 Prochlorococcus sp. scB243_498C16 GCA_000634995.1
GCA_000635015.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_498I20 Prochlorococcus sp. scB243_498I20 GCA_000635015.1
GCA_000635035.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_498L10 Prochlorococcus sp. scB243_498L10 GCA_000635035.1
GCA_000635055.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_518A6 Prochlorococcus sp. scB245a_518A6 GCA_000635055.1
GCA_000635075.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_518E10 Prochlorococcus sp. scB245a_518E10 GCA_000635075.1
GCA_000635095.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_518J7 Prochlorococcus sp. scB245a_518J7 GCA_000635095.1
GCA_000635115.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_518K17 Prochlorococcus sp. scB245a_518K17 GCA_000635115.1
GCA_000635135.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_518O7 Prochlorococcus sp. scB245a_518O7 GCA_000635135.1
GCA_000635155.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_519C7 Prochlorococcus sp. scB245a_519C7 GCA_000635155.1
GCA_000635175.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_519E23 Prochlorococcus sp. scB245a_519E23 GCA_000635175.1
GCA_000635195.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_519L21 Prochlorococcus sp. scB245a_519L21 GCA_000635195.1
GCA_000635215.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_521C8 Prochlorococcus sp. scB245a_521C8 GCA_000635215.1
GCA_000635235.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_521K15 Prochlorococcus sp. scB245a_521K15 GCA_000635235.1
GCA_000635255.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_521O20 Prochlorococcus sp. scB245a_521O20 GCA_000635255.1
GCA_000635275.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_526D20 Prochlorococcus sp. scB241_526D20 GCA_000635275.1
GCA_000635295.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_527G5 Prochlorococcus sp. scB241_527G5 GCA_000635295.1
GCA_000635315.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_527I9 Prochlorococcus sp. scB241_527I9 GCA_000635315.1
GCA_000635335.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_527L16 Prochlorococcus sp. scB241_527L16 GCA_000635335.1
GCA_000635355.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_527L22 Prochlorococcus sp. scB241_527L22 GCA_000635355.1
GCA_000635375.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_527P5 Prochlorococcus sp. scB241_527P5 GCA_000635375.1
GCA_000635395.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_528P18 Prochlorococcus sp. scB241_528P18 GCA_000635395.1
GCA_000635415.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_529B19 Prochlorococcus sp. scB241_529B19 GCA_000635415.1
GCA_000635435.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_529J11 Prochlorococcus sp. scB241_529J11 GCA_000635435.1
GCA_000635455.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_529J16 Prochlorococcus sp. scB241_529J16 GCA_000635455.1
GCA_000635475.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB241_529O19 Prochlorococcus sp. scB241_529O19 GCA_000635475.1
GCA_000635495.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_495K23 Prochlorococcus sp. scB243_495K23 GCA_000635495.1
GCA_000635515.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_495N3 Prochlorococcus sp. scB243_495N3 GCA_000635515.1
GCA_000635535.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_496M6 Prochlorococcus sp. scB243_496M6 GCA_000635535.1
GCA_000635555.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_496N4 Prochlorococcus sp. scB243_496N4 GCA_000635555.1
GCA_000635575.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_497E17 Prochlorococcus sp. scB243_497E17 GCA_000635575.1
GCA_000635595.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_498B23 Prochlorococcus sp. scB243_498B23 GCA_000635595.1
GCA_000635615.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_498F21 Prochlorococcus sp. scB243_498F21 GCA_000635615.1
GCA_000635635.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_498G3 Prochlorococcus sp. scB243_498G3 GCA_000635635.1
GCA_000635655.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_498M14 Prochlorococcus sp. scB243_498M14 GCA_000635655.1
GCA_000635675.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_498P15 Prochlorococcus sp. scB243_498P15 GCA_000635675.1
GCA_000635695.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB243_498P3 Prochlorococcus sp. scB243_498P3 GCA_000635695.1
GCA_000635715.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_518I6 Prochlorococcus sp. scB245a_518I6 GCA_000635715.1
GCA_000635735.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_519D13 Prochlorococcus sp. scB245a_519D13 GCA_000635735.1
GCA_000635755.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_519G16 Prochlorococcus sp. scB245a_519G16 GCA_000635755.1
GCA_000635775.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_519O11 Prochlorococcus sp. scB245a_519O11 GCA_000635775.1
GCA_000635795.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_520E22 Prochlorococcus sp. scB245a_520E22 GCA_000635795.1
GCA_000635815.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_520F22 Prochlorococcus sp. scB245a_520F22 GCA_000635815.1
GCA_000635835.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_521B10 Prochlorococcus sp. scB245a_521B10 GCA_000635835.1
GCA_000635855.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_521M10 Prochlorococcus sp. scB245a_521M10 GCA_000635855.1
GCA_000635875.1 CyanoBase Cyanobacteria Prochlorococcus sp. scB245a_521N5 Prochlorococcus sp. scB245a_521N5 GCA_000635875.1
GCA_000708525.1 CyanoBase Cyanobacteria Cyanobium sp. CACIAM 14 Cyanobium sp. CACIAM 14 GCA_000708525.1
GCA_000710505.1 CyanoBase Cyanobacteria Planktothrix agardhii NIVA-CYA 126/8 Planktothrix agardhii NIVA-CYA 126/8 GCA_000710505.1
GCA_000715475.1 CyanoBase Cyanobacteria Synechococcus sp. NKBG042902 Synechococcus sp. NKBG042902 GCA_000715475.1
GCA_000733415.1 CyanoBase Cyanobacteria Leptolyngbya sp. JSC-1 Leptolyngbya sp. JSC-1 GCA_000733415.1
GCA_000734895.2 CyanoBase Cyanobacteria Calothrix sp. 336/3 Calothrix sp. 336/3 GCA_000734895.2
GCA_000737535.1 CyanoBase Cyanobacteria Synechococcus sp. KORDI-100 Synechococcus sp. KORDI-100 GCA_000737535.1
GCA_000737575.1 CyanoBase Cyanobacteria Synechococcus sp. KORDI-49 Synechococcus sp. KORDI-49 GCA_000737575.1
GCA_000737595.1 CyanoBase Cyanobacteria Synechococcus sp. KORDI-52 Synechococcus sp. KORDI-52 GCA_000737595.1
GCA_000737945.1 CyanoBase Cyanobacteria Candidatus Atelocyanobacterium thalassa
isolate SIO64986
Candidatus Atelocyanobacterium thalassa
isolate SIO64986
GCA_000756305.1 CyanoBase Cyanobacteria Myxosarcina sp. GI1 Myxosarcina sp. GI1 GCA_000756305.1
GCA_000757845.1 CyanoBase Cyanobacteria Prochlorococcus sp. MIT 0604 Prochlorococcus sp. MIT 0604 GCA_000757845.1
GCA_000757865.1 CyanoBase Cyanobacteria Prochlorococcus sp. MIT 0801 Prochlorococcus sp. MIT 0801 GCA_000757865.1
GCA_000759855.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9107 Prochlorococcus marinus str. MIT 9107 GCA_000759855.1
GCA_000759865.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9116 Prochlorococcus marinus str. MIT 9116 GCA_000759865.1
GCA_000759875.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. EQPAC1 Prochlorococcus marinus str. EQPAC1 GCA_000759875.1
GCA_000759885.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. GP2 Prochlorococcus marinus str. GP2 GCA_000759885.1
GCA_000759935.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9123 Prochlorococcus marinus str. MIT 9123 GCA_000759935.1
GCA_000759955.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9201 Prochlorococcus marinus str. MIT 9201 GCA_000759955.1
GCA_000759975.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9302 Prochlorococcus marinus str. MIT 9302 GCA_000759975.1
GCA_000760015.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9311 Prochlorococcus marinus str. MIT 9311 GCA_000760015.1
GCA_000760035.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9314 Prochlorococcus marinus str. MIT 9314 GCA_000760035.1
GCA_000760055.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9321 Prochlorococcus marinus str. MIT 9321 GCA_000760055.1
GCA_000760075.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9322 Prochlorococcus marinus str. MIT 9322 GCA_000760075.1
GCA_000760095.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. MIT 9401 Prochlorococcus marinus str. MIT 9401 GCA_000760095.1
GCA_000760115.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. SB Prochlorococcus marinus str. SB GCA_000760115.1
GCA_000760155.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. LG Prochlorococcus marinus str. LG GCA_000760155.1
GCA_000760175.1 CyanoBase Cyanobacteria Prochlorococcus sp. MIT 0601 Prochlorococcus sp. MIT 0601 GCA_000760175.1
GCA_000760195.1 CyanoBase Cyanobacteria Prochlorococcus sp. MIT 0602 Prochlorococcus sp. MIT 0602 GCA_000760195.1
GCA_000760215.1 CyanoBase Cyanobacteria Prochlorococcus sp. MIT 0603 Prochlorococcus sp. MIT 0603 GCA_000760215.1
GCA_000760235.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. PAC1 Prochlorococcus marinus str. PAC1 GCA_000760235.1
GCA_000760255.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. SS2 Prochlorococcus marinus str. SS2 GCA_000760255.1
GCA_000760275.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. SS35 Prochlorococcus marinus str. SS35 GCA_000760275.1
GCA_000760295.1 CyanoBase Cyanobacteria Prochlorococcus sp. MIT 0701 Prochlorococcus sp. MIT 0701 GCA_000760295.1
GCA_000760315.1 CyanoBase Cyanobacteria Prochlorococcus sp. MIT 0702 Prochlorococcus sp. MIT 0702 GCA_000760315.1
GCA_000760335.1 CyanoBase Cyanobacteria Prochlorococcus sp. MIT 0703 Prochlorococcus sp. MIT 0703 GCA_000760335.1
GCA_000760355.1 CyanoBase Cyanobacteria Prochlorococcus marinus str. SS51 Prochlorococcus marinus str. SS51 GCA_000760355.1
GCA_000760375.1 CyanoBase Cyanobacteria Prochlorococcus sp. SS52 Prochlorococcus sp. SS52 GCA_000760375.1
GCA_000760695.2 CyanoBase Cyanobacteria Tolypothrix bouteillei VB521301 Tolypothrix bouteillei VB521301 GCA_000760695.2
GCA_000763385.1 CyanoBase Cyanobacteria Leptolyngbya sp. KIOST-1 Leptolyngbya sp. KIOST-1 GCA_000763385.1
GCA_000775285.1 CyanoBase Cyanobacteria Neosynechococcus sphagnicola sy1 Neosynechococcus sphagnicola sy1 GCA_000775285.1
GCA_000787675.1 CyanoBase Cyanobacteria Microcystis aeruginosa NIES-44 Microcystis aeruginosa NIES-44 GCA_000787675.1
GCA_000789435.1 CyanoBase Cyanobacteria Aphanizomenon flos-aquae 2012/KM1/D3 Aphanizomenon flos-aquae 2012/KM1/D3 GCA_000789435.1
GCA_000817325.1 CyanoBase Cyanobacteria Synechococcus sp. UTEX 2973 Synechococcus sp. UTEX 2973 GCA_000817325.1
GCA_000817735.1 CyanoBase Cyanobacteria Scytonema millei VB511283 Scytonema millei VB511283 GCA_000817735.1
GCA_000817745.1 CyanoBase Cyanobacteria Aphanocapsa montana BDHKU210001 Aphanocapsa montana BDHKU210001 GCA_000817745.1
GCA_000817775.1 CyanoBase Cyanobacteria Lyngbya confervoides BDU141951 Lyngbya confervoides BDU141951 GCA_000817775.1
GCA_000817785.1 CyanoBase Cyanobacteria Hassallia byssoidea VB512170 Hassallia byssoidea VB512170 GCA_000817785.1
GCA_000828075.1 CyanoBase Cyanobacteria Tolypothrix campylonemoides VB511288 Tolypothrix campylonemoides VB511288 GCA_000828075.1
GCA_000828085.1 CyanoBase Cyanobacteria Scytonema tolypothrichoides VB-61278 Scytonema tolypothrichoides VB-61278 GCA_000828085.1
GCA_000829235.1 CyanoBase Cyanobacteria cyanobacterium endosymbiont of
Epithemia turgida isolate EtSB Lake Yunoko
cyanobacterium endosymbiont of
Epithemia turgida isolate EtSB Lake Yunoko
GCA_000934435.1 CyanoBase Cyanobacteria Mastigocladus laminosus UU774 Mastigocladus laminosus UU774 GCA_000934435.1
GCA_000952155.1 CyanoBase Cyanobacteria Chroococcales cyanobacterium CENA595 Chroococcales cyanobacterium CENA595 GCA_000952155.1
GCA_000963755.2 CyanoBase Cyanobacteria Trichodesmium erythraeum 21-75 Trichodesmium erythraeum 21-75 GCA_000963755.2
GCA_000972705.2 CyanoBase Cyanobacteria Limnoraphis robusta CS-951 Limnoraphis robusta CS-951 GCA_000972705.2
GCA_000973065.1 CyanoBase Cyanobacteria Arthrospira sp. PCC 8005 Arthrospira sp. PCC 8005 GCA_000973065.1
GCA_000974245.1 CyanoBase Cyanobacteria Arthrospira sp. TJSD091 Arthrospira sp. TJSD091 GCA_000974245.1
GCA_000981785.1 CyanoBase Cyanobacteria Microcystis aeruginosa NIES-2549 Microcystis aeruginosa NIES-2549 GCA_000981785.1
GCA_000987385.1 CyanoBase Cyanobacteria Trichodesmium thiebautii H9-4 Trichodesmium thiebautii H9-4 GCA_000987385.1
GCA_001007625.1 CyanoBase Cyanobacteria Candidatus Synechococcus spongiarum 142 Candidatus Synechococcus spongiarum 142 GCA_001007625.1
GCA_001007635.1 CyanoBase Cyanobacteria Candidatus Synechococcus spongiarum 15L Candidatus Synechococcus spongiarum 15L GCA_001007635.1
GCA_001007665.1 CyanoBase Cyanobacteria Candidatus Synechococcus spongiarum SP3 Candidatus Synechococcus spongiarum SP3 GCA_001007665.1
GCA_001039265.1 CyanoBase Cyanobacteria Synechococcus sp. GFB01 Synechococcus sp. GFB01 GCA_001039265.1
GCA_001039555.1 CyanoBase Cyanobacteria Crocosphaera watsonii WH 8502 Crocosphaera watsonii WH 8502 GCA_001039555.1
GCA_001039615.1 CyanoBase Cyanobacteria Crocosphaera watsonii WH 0401 Crocosphaera watsonii WH 0401 GCA_001039615.1
GCA_001039635.1 CyanoBase Cyanobacteria Crocosphaera watsonii WH 0402 Crocosphaera watsonii WH 0402 GCA_001039635.1
GCA_001040845.1 CyanoBase Cyanobacteria Synechococcus sp. WH 8020 Synechococcus sp. WH 8020 GCA_001040845.1
GCA_001050835.1 CyanoBase Cyanobacteria Crocosphaera watsonii WH 0005 Crocosphaera watsonii WH 0005 GCA_001050835.1
GCA_001180245.1 CyanoBase Cyanobacteria Prochlorococcus marinus Prochlorococcus marinus GCA_001180245.1
GCA_001180265.1 CyanoBase Cyanobacteria Prochlorococcus marinus Prochlorococcus marinus GCA_001180265.1
GCA_001180285.1 CyanoBase Cyanobacteria Prochlorococcus marinus Prochlorococcus marinus GCA_001180285.1
GCA_001180305.1 CyanoBase Cyanobacteria Prochlorococcus marinus Prochlorococcus marinus GCA_001180305.1
GCA_001180325.1 CyanoBase Cyanobacteria Prochlorococcus marinus Prochlorococcus marinus GCA_001180325.1
GCA_001182765.1 CyanoBase Cyanobacteria Synechococcus sp. WH 8103 Synechococcus sp. WH 8103 GCA_001182765.1
GCA_001264245.1 CyanoBase Cyanobacteria Microcystis panniformis FACHB-1757 Microcystis panniformis FACHB-1757 GCA_001264245.1
GCA_001275395.1 CyanoBase Cyanobacteria Hapalosiphon sp. MRB220 Hapalosiphon sp. MRB220 GCA_001275395.1
GCA_001276715.1 CyanoBase Cyanobacteria Planktothricoides sp. SR001 Planktothricoides sp. SR001 GCA_001276715.1
GCA_001277295.1 CyanoBase Cyanobacteria Anabaena sp. wa102 Anabaena sp. wa102 GCA_001277295.1
GCA_001298445.1 CyanoBase Cyanobacteria Nostoc piscinale CENA21 Nostoc piscinale CENA21 GCA_001298445.1
GCA_001314865.1 CyanoBase Cyanobacteria Phormidesmis priestleyi Ana Phormidesmis priestleyi Ana GCA_001314865.1
GCA_001314905.1 CyanoBase Cyanobacteria Phormidium sp. OSCR Phormidium sp. OSCR GCA_001314905.1
GCA_001318385.1 CyanoBase Cyanobacteria Synechocystis sp. PCC 6803 Synechocystis sp. PCC 6803 GCA_001318385.1
GCA_001402795.1 CyanoBase Cyanobacteria Pseudanabaena sp. Roaring Creek Pseudanabaena sp. Roaring Creek GCA_001402795.1
GCA_001456025.1 CyanoBase Cyanobacteria Mastigocoleus testarum BC008 Mastigocoleus testarum BC008 GCA_001456025.1
GCA_001458455.1 CyanoBase Cyanobacteria Chrysosporum ovalisporum Chrysosporum ovalisporum GCA_001458455.1
Illustrated overview of specificity check


CRISPRdirect results can be directly retrieved in HTML, tab-delimited text or JSON format by simply POSTing these values to using any kind of language or script. A sample Perl code is available from GitHub.

Name Required
or Optional
Description Sample Value
userseq Required A nucleotide sequence; FASTA format or
a plain nucleotide sequence up to 10 kbp.
atgccgcgcgtcgtgcccgaccagagaagc ...
accession Optional Retrieve sequence mode. Set an accession
number to retrieve sequence from GenBank
instead of designing CRISPR/Cas targets.
Genome location is also accepted for
hg19, mm10, rn5, galGal4, xenTro3,
danRer7, ci2, dm3, ce10 and sacCer3.
The variable userseq should be null.
The variable format should be 'html' or 'txt'.
pam Optional An arbitrary 3 nt sequence using IUB codes
can be specified.
NGG (default), NAG, ...
db Optional Set species for off-target searching. hg19 - Human (Homo sapiens); default,
mm10 - Mouse (Mus musculus),
rn5 - Rat (Rattus norvegicus), etc.
[Full list of species]
format Optional Output format. html (default), txt, json
download Optional Set 'download' to download result as a file. download

Useful tools


If you use CRISPRdirect in your work, please cite:

What's new

CRISPRdirect team

Yuki Naito1, Kimihiro Hino2, Hidemasa Bono1, Kumiko Ui-Tei2
1Database Center for Life Science (DBCLS) and 2University of Tokyo

This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use CRISPRdirect in your work, please cite:
Naito Y, Hino K, Bono H, Ui-Tei K. (2015)
CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites.
Bioinformatics, 31, 1120-1123. [Full Text]